National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17780R-3 
 Symbol CG17780  Full Name CG17780 
 CG No CG17780  Old CG No CG17780 
 Synonyms BcDNA:RE41041, CG17780 
 Accession No (Link to NCBI) NM_143002.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCATTGCTGATGCTGCACTTG 
 Primer Seq. 3'
aatctagaggtaccTGCTTGGGATTATCCACATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCANTTGCTG ATGCTGCACT TGCTCCTGGT GGTGCCCATA CCGGCGTCCA ATCCGCCCGT 
0061 CACTCAACCC CAACCCGTTG ACAATTTCGA GGGGCTCAGT CCACTGTCCA AACATTTCGA 
0121 TAGCCACATG GTCAGTCCAT CGACCAGCAA TATTCCCAGC TCCGACTTTG ATTCCGCATC 
0181 CGGCAATTCC ACAAGGATTT CTGCGTCGCG GCAAGCGTTA TCTTCAATTC AGCAAGGGAT 
0241 CACGTATGTC GTGGCGTACC AACGGCAAGA ACAATCTGTG GACAATCAAC ACTCTGGTAT 
0301 GCCTACGGCT ATGGCTTTCC GTGCCAATTA TCCCTTTCCA TCCATCGAGG AGCAGAAGAA 
0361 GGATAATGCC GTCTTTTTTC GCCTGTTCAA GAGGGACCTC TTCTCAAAAC TGGAGACTGC 
0421 TCTGGATGGA CATGGCTTCG ATGGTCGAGC TTGCATGCTG AAGTCGTTCT GCACTGCCAT 
0481 TAACGATGTG GATAATCCCA ANGCa 
 in silico PCR Fragment
0001 GCA-TTGCTG ATGCTGCACT TGCTCCTGGT GGTGCCCATA CCGGCGTCCA ATCCGCCCGT 
0061 CACTCAACCC CAACCCGTTG ACAATTTCGA GGGGCTCAGT CCACTGTCCA AACATTTCGA 
0121 TAGCCACATG GTCAGTCCAT CGACCAGCAA TATTCCCAGC TCCGACTTTG ATTCCGCATC 
0181 CGGCAATTCC ACAAGGA-TT CTGCGTCGCG GCAAGCGTTA TCTTCAATTC AGCAAGGGAT 
0241 CACGTATGTC GTGGCGTACC AACGGCAAGA ACAATCTGTG GACAATCAAC ACTCT-GTAT 
0301 GCCTACGGCT ATGGC-TTCC GTGCCAATTA TCCCTTTCCA TCCATCGAGG AGCAGAAGAA 
0361 GGATAATGCC GTCTTTTTTC GCCTGTTCAA GAGGGACCTC TTCTCAAAAC TGGAGACTGC 
0421 TCTGGATGGA CATGGCTTCG ATGGTCGAGC TTGCATGCTG AAGTCGTTCT GCACTGCCAT 
0481 TAACGATGTG GATAATCCCA A-GCA 
 Assemble Data

17780R-3.IR_full       1   GCANTTGCTGATGCTGCACTTGCTCCTGGTGGTGCCCATACCGGCGTCCAATCCGCCCGT 60
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     1   GCA-TTGCTGATGCTGCACTTGCTCCTGGTGGTGCCCATACCGGCGTCCAATCCGCCCGT 60


17780R-3.IR_full       61  CACTCAACCCCAACCCGTTGACAATTTCGAGGGGCTCAGTCCACTGTCCAAACATTTCGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     61  CACTCAACCCCAACCCGTTGACAATTTCGAGGGGCTCAGTCCACTGTCCAAACATTTCGA 120


17780R-3.IR_full       121 TAGCCACATGGTCAGTCCATCGACCAGCAATATTCCCAGCTCCGACTTTGATTCCGCATC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     121 TAGCCACATGGTCAGTCCATCGACCAGCAATATTCCCAGCTCCGACTTTGATTCCGCATC 180


17780R-3.IR_full       181 CGGCAATTCCACAAGGATTTCTGCGTCGCGGCAAGCGTTATCTTCAATTCAGCAAGGGAT 240
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     181 CGGCAATTCCACAAGGA-TTCTGCGTCGCGGCAAGCGTTATCTTCAATTCAGCAAGGGAT 240


17780R-3.IR_full       241 CACGTATGTCGTGGCGTACCAACGGCAAGAACAATCTGTGGACAATCAACACTCTGGTAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
17780R-3.in silico     241 CACGTATGTCGTGGCGTACCAACGGCAAGAACAATCTGTGGACAATCAACACTCT-GTAT 300


17780R-3.IR_full       301 GCCTACGGCTATGGCTTTCCGTGCCAATTATCCCTTTCCATCCATCGAGGAGCAGAAGAA 360
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     301 GCCTACGGCTATGGC-TTCCGTGCCAATTATCCCTTTCCATCCATCGAGGAGCAGAAGAA 360


17780R-3.IR_full       361 GGATAATGCCGTCTTTTTTCGCCTGTTCAAGAGGGACCTCTTCTCAAAACTGGAGACTGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     361 GGATAATGCCGTCTTTTTTCGCCTGTTCAAGAGGGACCTCTTCTCAAAACTGGAGACTGC 420


17780R-3.IR_full       421 TCTGGATGGACATGGCTTCGATGGTCGAGCTTGCATGCTGAAGTCGTTCTGCACTGCCAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17780R-3.in silico     421 TCTGGATGGACATGGCTTCGATGGTCGAGCTTGCATGCTGAAGTCGTTCTGCACTGCCAT 480


17780R-3.IR_full       481 TAACGATGTGGATAATCCCAANGCA 505
                           ||||||||||||||||||||| |||
17780R-3.in silico     481 TAACGATGTGGATAATCCCAA-GCA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170143.1  CG17780-RB, transcript variant B (CG17780), mRNA 
100   482  NM_143002.1  CG17780-RA, transcript variant A (CG17780), mRNA 
0.2   NM_136740.2  CG12896-RA (CG12896), mRNA 
0.2   NM_165769.1  CG12405-RA (Prx2540-1), mRNA 
0.2   NM_078959.3  CG11765-RA (Prx2540-2), mRNA 
0   NM_142474.1  CG14304-RA (CG14304), mRNA 
0   NM_135534.1  CG4972-RA (CG4972), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_079711.2  CG6545-RA (lbe), mRNA 
0   NM_141331.2  CG1100-RA (Rpn5), mRNA 
0   NM_206439.1  CG31481-RD, transcript variant D (pb), mRNA 
0   NM_057321.4  CG31481-RA, transcript variant A (pb), mRNA 
0   NM_206441.1  CG31481-RB, transcript variant B (pb), mRNA 
0   NM_206440.1  CG31481-RC, transcript variant C (pb), mRNA 
0   NM_176603.1  CG31000-RH, transcript variant H (heph), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_143792.2  CG13432-RA (l(2)05510), mRNA 
0   NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_137830.1  CG3701-RA (CG3701), mRNA 
0   NM_137992.1  CG5549-RA (CG5549), mRNA 
0   10  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   13  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   13  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   13  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   13  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.