National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17760R-1 
 Symbol CG17760  Full Name CG17760 
 CG No CG17760  Old CG No CG17760 
 Synonyms BcDNA:SD21019, CG17760 
 Accession No (Link to NCBI) NM_001043074.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTGGACAAGGAGAGGAAGCA 
 Primer Seq. 3'
aatctagaggtaccCGGACATGGCAACCAAAAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTGGACAAG GAGAGGAAGC AGTTCACCAA AAATGTTTTC CAAAACATAT TCATGGCCAT 
0061 GCAGTCGATG ATCAGTGCAA TGGATACTCT GCGAATTCCC TACGGTCAGC AGGAGCATAG 
0121 TAAACTTGCC GATCTGGTGA AGAGCATCGA TTACAAGACA GTTACCAGAC TGGAGGCGCC 
0181 CTACTTGAAT GCCATCAAAA CGCTTTGGAA AGATGCTGGC ATCAAGGAGT GCTACAATCG 
0241 TCGTAGGGAA TATCAGCTGA CTGATTCAAC TGAATACTTT TTGAATGACA TAGCGCGAAT 
0301 TGAACGGAGT GATTACCAGG CCACTGATCA GGACATTCTT CATGTTCGAG CGCCAACAAC 
0361 CAATATTGTT GAGTATCCCT TCAATTTGGA CGGTTTTCTG ATAAGATTGG TGGACGTCGC 
0421 TGGTCAGCGA ACGGAGAGAA GAAAGTGGAT TCATTGTTTT TCCAATGTGA CATCAATTAT 
0481 GTTTTTGGTT GCCATGTCCG  
 in silico PCR Fragment
0001 TTTGGACAAG GAGAGGAAGC AGTTCACCAA AAATGTTTTC CAAAACATAT TCATGGCCAT 
0061 ACAGTCGATG ATCAGTGCAA TGGATACTCT GCGAATTCCC TACGGTCAGC AGGAGCATAG 
0121 TAAACTTGCC GATCTGGTGA AGAGCATCGA TTACAAGACA GTTACCAGAC TGGAGGCGCC 
0181 CTACTTGAAT GCCATCAAAA CTCTTTGGAA AGATGCTGGC ATCAAGGAGT GCTACAATCG 
0241 TCGTAGGGAA TATCAGCTGA CTGATTCAAC TGAATACTTT TTGAATGACA TAGCGCGAAT 
0301 TGAACGGAGT GATTACCAGG CCACTGATCA GGACATTCTT CATGTTCGAG CGCCAACAAC 
0361 CAATATTGTT GAGTATCCCT TCAATTTGGA CGGTTTTCTG ATAAGATTGG TGGACGTCGC 
0421 TGGTCAGCGA ACGGAGAGAA GAAAGTGGAT TCATTGTTTT TCCAATGTGA CATCAATTAT 
0481 GTTTTTGGTT GCCATGTCCG  
 Assemble Data

17760R-1.IR_full       1   TTTGGACAAGGAGAGGAAGCAGTTCACCAAAAATGTTTTCCAAAACATATTCATGGCCAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     1   TTTGGACAAGGAGAGGAAGCAGTTCACCAAAAATGTTTTCCAAAACATATTCATGGCCAT 60


17760R-1.IR_full       61  GCAGTCGATGATCAGTGCAATGGATACTCTGCGAATTCCCTACGGTCAGCAGGAGCATAG 120
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     61  ACAGTCGATGATCAGTGCAATGGATACTCTGCGAATTCCCTACGGTCAGCAGGAGCATAG 120


17760R-1.IR_full       121 TAAACTTGCCGATCTGGTGAAGAGCATCGATTACAAGACAGTTACCAGACTGGAGGCGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     121 TAAACTTGCCGATCTGGTGAAGAGCATCGATTACAAGACAGTTACCAGACTGGAGGCGCC 180


17760R-1.IR_full       181 CTACTTGAATGCCATCAAAACGCTTTGGAAAGATGCTGGCATCAAGGAGTGCTACAATCG 240
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     181 CTACTTGAATGCCATCAAAACTCTTTGGAAAGATGCTGGCATCAAGGAGTGCTACAATCG 240


17760R-1.IR_full       241 TCGTAGGGAATATCAGCTGACTGATTCAACTGAATACTTTTTGAATGACATAGCGCGAAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     241 TCGTAGGGAATATCAGCTGACTGATTCAACTGAATACTTTTTGAATGACATAGCGCGAAT 300


17760R-1.IR_full       301 TGAACGGAGTGATTACCAGGCCACTGATCAGGACATTCTTCATGTTCGAGCGCCAACAAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     301 TGAACGGAGTGATTACCAGGCCACTGATCAGGACATTCTTCATGTTCGAGCGCCAACAAC 360


17760R-1.IR_full       361 CAATATTGTTGAGTATCCCTTCAATTTGGACGGTTTTCTGATAAGATTGGTGGACGTCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     361 CAATATTGTTGAGTATCCCTTCAATTTGGACGGTTTTCTGATAAGATTGGTGGACGTCGC 420


17760R-1.IR_full       421 TGGTCAGCGAACGGAGAGAAGAAAGTGGATTCATTGTTTTTCCAATGTGACATCAATTAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17760R-1.in silico     421 TGGTCAGCGAACGGAGAGAAGAAAGTGGATTCATTGTTTTTCCAATGTGACATCAATTAT 480


17760R-1.IR_full       481 GTTTTTGGTTGCCATGTCCG 500
                           ||||||||||||||||||||
17760R-1.in silico     481 GTTTTTGGTTGCCATGTCCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001043074.1  CG17760-RB (CG17760), mRNA 
4.35   21  47  80  78  NM_165925.1  CG17759-RF, transcript variant F (Galpha49B), mRNA 
4.35   21  47  80  78  NM_165924.1  CG17759-RD, transcript variant D (Galpha49B), mRNA 
4.35   21  47  77  78  NM_165919.1  CG17759-RA, transcript variant A (Galpha49B), mRNA 
4.35   21  47  77  78  NM_165923.1  CG17759-RG, transcript variant G (Galpha49B), mRNA 
4.35   21  47  77  69  NM_165921.1  CG17759-RC, transcript variant C (Galpha49B), mRNA 
4.35   21  47  77  69  NM_165922.1  CG17759-RE, transcript variant E (Galpha49B), mRNA 
4.35   21  47  77  69  NM_078994.2  CG17759-RH, transcript variant H (Galpha49B), mRNA 
4.35   21  47  77  69  NM_165920.1  CG17759-RB, transcript variant B (Galpha49B), mRNA 
3.11   15  45  87  92  NM_001043073.1  CG30054-RC (CG30054), mRNA 
0   NM_135265.1  CG4971-RA (Wnt10), mRNA 
0   16  16  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   16  16  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   16  16  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_166260.1  CG30110-RA (CG30110), mRNA 
0   NM_139920.1  CG7504-RA (CG7504), mRNA 
0   NM_057576.3  CG6407-RA (Wnt5), mRNA 
0   NM_136745.3  CG12892-RA (Caf1-105), mRNA 
0   NM_137456.2  CG5733-RA (CG5733), mRNA 
0   NM_205982.1  CG6214-RM, transcript variant M (MRP), mRNA 
0   NM_205980.1  CG6214-RO, transcript variant O (MRP), mRNA 
0   NM_205976.1  CG6214-RD, transcript variant D (MRP), mRNA 
0   NM_205975.1  CG6214-RE, transcript variant E (MRP), mRNA 
0   NM_205974.1  CG6214-RF, transcript variant F (MRP), mRNA 
0   NM_205977.1  CG6214-RC, transcript variant C (MRP), mRNA 
0   NM_165020.2  CG6214-RA, transcript variant A (MRP), mRNA 
0   NM_205973.1  CG6214-RG, transcript variant G (MRP), mRNA 
0   NM_205979.1  CG6214-RP, transcript variant P (MRP), mRNA 
0   NM_205972.1  CG6214-RH, transcript variant H (MRP), mRNA 
0   NM_205970.1  CG6214-RJ, transcript variant J (MRP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.