National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17759R-2 
 Symbol Galpha49B  Full Name G protein alpha49B 
 CG No CG17759  Old CG No CG17759 
 Synonyms dgq, Galpha49b, dGqalpha, Galpha[[q]], G[q], Gq, Galphaq, Galpha, Gqalpha, G[[alphaq]], G[[q]], DGqalpha, G[[a]]q, Gaq, G[[q]]alpha, G alpha 49B, CG17759, dGaalpha, dGqalpha-49b, dGqa-49b, Gqa-3, Galpha49B, Dgq, DmGalpha[[q]], dGqalpha-3, DGq, G[[qalpha]], dG[[q]]alpha, DGalphaq, dgqalpha, dG[[alphaq]], DGalpha[[q]], G?q 
 Accession No (Link to NCBI) NM_165919.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGTGCTGTTTATCGGA 
 Primer Seq. 3'
aatctagaggtaccTAAATATGCAGGTTGAGCCA 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ATGGAGTGCT GTTTATCGGA GGAGGCCAAG GAACAAAAGC GCATCAATCA GGAAATCGAG 
0061 AAGCAGTTGC GCCGGGACAA GAGAGATGCG CGCCGCGAGC TTAAACTGCT ACTACTGGGC 
0121 ACTGGCGAGT CCGGGAAGTC CACATTCATC AAACAGATGC GTATTATCCA CGGCAGCGGT 
0181 TACTCGGACG AGGACAAGCG TGGGTACATC AAGCTGGTTT TTCAGAACAT ATTCATGGCC 
0241 ATGCAGTCAA TGATCAAGGC CATGGATATG CTGAAGATTT CCTACGGTCA GGGAGAGCAT 
0301 AGTGAACTGG CCGATCTGGT GATGAGCATC GATTATGAGA CCGTTACCAC GTTCGAGGAT 
0361 CCATACTTGA ATGCCATCAA AACGCTTTGG GACGATGCTG GCATCCAGGA GTGCTATGAT 
0421 CGTCGTAGGG AATATCAGCT GACTGATTCA GCCAAATATT ATCTGAAGGA TCTCGATCGT 
0481 GTGGCTCAAC CTGCATATTT A 
 in silico PCR Fragment
0001 ATGGAGTGCT GTTTATCGGA GGAGGCCAAG GAACAAAAGC GCATCAATCA GGAAATCGAG 
0061 AAGCAGTTGC GCCGGGACAA GAGAGATGCG CGCCGCGAGC TTAAACTGCT ACTACTGGGC 
0121 ACTGGCGAGT CCGGGAAGTC CACATTCATC AAACAGATGC GTATTATCCA CGGCAGCGGT 
0181 TACTCGGACG AGGACAAGCG TGGGTACATC AAGCTGGTTT TTCAGAACAT ATTCATGGCC 
0241 ATGCAGTCAA TGATCAAGGC CATGGATATG CTGAAGATTT CCTACGGCCA GGGAGAGCAT 
0301 AGTGAACTGG CCGATCTGGT GATGAGCATC GATTATGAGA CCGTTACCAC GTTCGAGGAT 
0361 CCATACTTGA ATGCCATCAA AACGCTTTGG GACGATGCTG GCATCCAGGA GTGCTATGAT 
0421 CGTCGTAGGG AATATCAGCT GACTGATTCA GCCAAATATT ATCTGAAGGA TCTCGATCGT 
0481 GTGGCTCAAC CTGCATATTT A 
 Assemble Data

17759R-2.IR_full       1   ATGGAGTGCTGTTTATCGGAGGAGGCCAAGGAACAAAAGCGCATCAATCAGGAAATCGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     1   ATGGAGTGCTGTTTATCGGAGGAGGCCAAGGAACAAAAGCGCATCAATCAGGAAATCGAG 60


17759R-2.IR_full       61  AAGCAGTTGCGCCGGGACAAGAGAGATGCGCGCCGCGAGCTTAAACTGCTACTACTGGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     61  AAGCAGTTGCGCCGGGACAAGAGAGATGCGCGCCGCGAGCTTAAACTGCTACTACTGGGC 120


17759R-2.IR_full       121 ACTGGCGAGTCCGGGAAGTCCACATTCATCAAACAGATGCGTATTATCCACGGCAGCGGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     121 ACTGGCGAGTCCGGGAAGTCCACATTCATCAAACAGATGCGTATTATCCACGGCAGCGGT 180


17759R-2.IR_full       181 TACTCGGACGAGGACAAGCGTGGGTACATCAAGCTGGTTTTTCAGAACATATTCATGGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     181 TACTCGGACGAGGACAAGCGTGGGTACATCAAGCTGGTTTTTCAGAACATATTCATGGCC 240


17759R-2.IR_full       241 ATGCAGTCAATGATCAAGGCCATGGATATGCTGAAGATTTCCTACGGTCAGGGAGAGCAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
17759R-2.in silico     241 ATGCAGTCAATGATCAAGGCCATGGATATGCTGAAGATTTCCTACGGCCAGGGAGAGCAT 300


17759R-2.IR_full       301 AGTGAACTGGCCGATCTGGTGATGAGCATCGATTATGAGACCGTTACCACGTTCGAGGAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     301 AGTGAACTGGCCGATCTGGTGATGAGCATCGATTATGAGACCGTTACCACGTTCGAGGAT 360


17759R-2.IR_full       361 CCATACTTGAATGCCATCAAAACGCTTTGGGACGATGCTGGCATCCAGGAGTGCTATGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     361 CCATACTTGAATGCCATCAAAACGCTTTGGGACGATGCTGGCATCCAGGAGTGCTATGAT 420


17759R-2.IR_full       421 CGTCGTAGGGAATATCAGCTGACTGATTCAGCCAAATATTATCTGAAGGATCTCGATCGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17759R-2.in silico     421 CGTCGTAGGGAATATCAGCTGACTGATTCAGCCAAATATTATCTGAAGGATCTCGATCGT 480


17759R-2.IR_full       481 GTGGCTCAACCTGCATATTTA 501
                           |||||||||||||||||||||
17759R-2.in silico     481 GTGGCTCAACCTGCATATTTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_165919.1  CG17759-RA, transcript variant A (Galpha49B), mRNA 
100   483  NM_165923.1  CG17759-RG, transcript variant G (Galpha49B), mRNA 
100   483  NM_165921.1  CG17759-RC, transcript variant C (Galpha49B), mRNA 
100   483  NM_165922.1  CG17759-RE, transcript variant E (Galpha49B), mRNA 
100   483  NM_078994.2  CG17759-RH, transcript variant H (Galpha49B), mRNA 
100   483  NM_165920.1  CG17759-RB, transcript variant B (Galpha49B), mRNA 
91.09   440  NM_165924.1  CG17759-RD, transcript variant D (Galpha49B), mRNA 
91.09   440  NM_165925.1  CG17759-RF, transcript variant F (Galpha49B), mRNA 
47.82   231  78  23  NM_001043073.1  CG30054-RC (CG30054), mRNA 
3.31   16  39  61  60  NM_001043074.1  CG17760-RB (CG17760), mRNA 
0.41   NM_136870.1  CG13188-RB, transcript variant B (CG13188), mRNA 
0.41   NM_165853.1  CG13188-RA, transcript variant A (CG13188), mRNA 
0.2   NM_079446.2  CG8637-RA (trc), mRNA 
0   NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   NM_141832.2  CG5344-RA, transcript variant A (wkd), mRNA 
0   NM_169402.2  CG5344-RB, transcript variant B (wkd), mRNA 
0   NM_142329.2  CG3590-RA (CG3590), mRNA 
0   NM_136467.2  CG12042-RA (CG12042), mRNA 
0   NM_132034.1  CG3108-RA (CG3108), mRNA 
0   NM_138236.1  CG9122-RA (Trh), mRNA 
0   NM_140015.2  CG5651-RA, transcript variant A (CG5651), mRNA 
0   NM_168306.1  CG5651-RB, transcript variant B (CG5651), mRNA 
0   NM_135011.2  CG15631-RA (CG15631), mRNA 
0   NM_136464.1  CG2070-RA (CG2070), mRNA 
0   11  NM_132216.2  CG2116-RA (CG2116), mRNA 
0   NM_142312.1  CG14905-RA (CG14905), mRNA 
0   NM_142556.2  CG6240-RA (CG6240), mRNA 
0   NM_132614.2  CG4396-RA (fne), mRNA 
0   NM_131920.2  CG6379-RA (CG6379), mRNA 
0   NM_140329.2  CG4107-RA (Pcaf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.