National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17753R-2 
 Symbol CCS  Full Name CCS 
 CG No CG17753  Old CG No CG17753 
 Synonyms CG17753, CCD, l(2)03221, anon-EST:Posey231, CCS 
 Accession No (Link to NCBI) NM_143772.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGAGGTGACGAATCCTATGC 
 Primer Seq. 3'
aatctagaggtaccCAAATCTAAAGGTGGCCCTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGAGGTGAC GAATCCTATG CCGGTGCCCT CCGTTCGGCG CTGGATGGGG TCGGCCAGGT 
0061 GGAAATTGAC ACCCAGGAAG GTCGAGTGAT AATCCAAACC CAACGACCTT GGTCAGAGAT 
0121 TCAGGACAAG ATAGAAGCCA CAGGTGTCCG GGCCGTACTC TCCGGATTCG GCGGACAGTC 
0181 GGCGGTGGCC CTTATTAACA CAACAGGAAG TGTAGTGGAC AAGACACCAA TCCAGGGAGT 
0241 GGTTCGGTTT ACCACCATTA CCGCAGACAA GAAGCCTGGA GTGGTTGTGG ATGGCGTTGT 
0301 GGACGGTCTA TCGCCTGGAC TGCACGGATT ACATATTCAC GAGAGTGGTG ACACTTCCGC 
0361 AGGTTGCTCG TCGGTCGGAG AACACTACAA TCCCCGCCAG TCGCCACATG GAAGCCCTGC 
0421 AGCTGGGGCA GAGGAGCGGC ACGCCGGAGA TCTTGGCAAC ATCCGAGCGG ATGAAAACGG 
0481 CAGGGCCACC TTTAGATTTG  
 in silico PCR Fragment
0001 AAGAGGTGAC GAATCCTATG CCGGTGCCCT CCGTTCGGCG CTGGATGGGG TCGGCCAGGT 
0061 GGAAATTGAC ACCCAGGAAG GTCGAGTGAT AATCCAAACC CAACGACCTT GGTCAGAGAT 
0121 TCAGGACAAG ATAGAAGCCA CAGGTGTCCG GGCCGTACTC TCCGGATTCG GCGGCCAGTC 
0181 GGCGGTGGCC CTTATAAACA CAACAGGAAG TGTAGTGGAC AAGACACCAA TCCAGGGAGT 
0241 GGTTCGGTTT ACCACCATTA CCGCAGACAA GAAGCCTGGA GTGGTTGTGG ATGGCGTTGT 
0301 GGACGGTCTA TCGCCTGGAC TGCACGGATT ACATATTCAC GAGAGTGGTG ACACTTCCGC 
0361 AGGTTGCTCG TCGGTCGGAG AACACTACAA TCCCCGCCAG TCGCCACATG GAAGCCCTGC 
0421 AGCTGGGGCA GAGGAGCGGC ACGCCGGAGA TCTTGGCAAC ATCCGAGCGG ATGAAAACGG 
0481 CAGGGCCACC TTTAGATTTG  
 Assemble Data

17753R-2.IR_full       1   AAGAGGTGACGAATCCTATGCCGGTGCCCTCCGTTCGGCGCTGGATGGGGTCGGCCAGGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     1   AAGAGGTGACGAATCCTATGCCGGTGCCCTCCGTTCGGCGCTGGATGGGGTCGGCCAGGT 60


17753R-2.IR_full       61  GGAAATTGACACCCAGGAAGGTCGAGTGATAATCCAAACCCAACGACCTTGGTCAGAGAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     61  GGAAATTGACACCCAGGAAGGTCGAGTGATAATCCAAACCCAACGACCTTGGTCAGAGAT 120


17753R-2.IR_full       121 TCAGGACAAGATAGAAGCCACAGGTGTCCGGGCCGTACTCTCCGGATTCGGCGGACAGTC 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
17753R-2.in silico     121 TCAGGACAAGATAGAAGCCACAGGTGTCCGGGCCGTACTCTCCGGATTCGGCGGCCAGTC 180


17753R-2.IR_full       181 GGCGGTGGCCCTTATTAACACAACAGGAAGTGTAGTGGACAAGACACCAATCCAGGGAGT 240
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     181 GGCGGTGGCCCTTATAAACACAACAGGAAGTGTAGTGGACAAGACACCAATCCAGGGAGT 240


17753R-2.IR_full       241 GGTTCGGTTTACCACCATTACCGCAGACAAGAAGCCTGGAGTGGTTGTGGATGGCGTTGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     241 GGTTCGGTTTACCACCATTACCGCAGACAAGAAGCCTGGAGTGGTTGTGGATGGCGTTGT 300


17753R-2.IR_full       301 GGACGGTCTATCGCCTGGACTGCACGGATTACATATTCACGAGAGTGGTGACACTTCCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     301 GGACGGTCTATCGCCTGGACTGCACGGATTACATATTCACGAGAGTGGTGACACTTCCGC 360


17753R-2.IR_full       361 AGGTTGCTCGTCGGTCGGAGAACACTACAATCCCCGCCAGTCGCCACATGGAAGCCCTGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     361 AGGTTGCTCGTCGGTCGGAGAACACTACAATCCCCGCCAGTCGCCACATGGAAGCCCTGC 420


17753R-2.IR_full       421 AGCTGGGGCAGAGGAGCGGCACGCCGGAGATCTTGGCAACATCCGAGCGGATGAAAACGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17753R-2.in silico     421 AGCTGGGGCAGAGGAGCGGCACGCCGGAGATCTTGGCAACATCCGAGCGGATGAAAACGG 480


17753R-2.IR_full       481 CAGGGCCACCTTTAGATTTG 500
                           ||||||||||||||||||||
17753R-2.in silico     481 CAGGGCCACCTTTAGATTTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143772.3  CG17753-RA (CCS), mRNA 
0   NM_079997.2  CG13580-RA (Crtp), mRNA 
0   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_141151.2  CG11370-RA (CG11370), mRNA 
0   NM_166909.2  CG14814-RA, transcript variant A (CG14814), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 
0   NM_141158.3  CG7369-RA (CG7369), mRNA 
0   NM_140596.1  CG13071-RA (CG13071), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   10  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_168270.1  CG32356-RB, transcript variant B (ImpE1), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_135123.2  CG9021-RA (CG9021), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_168162.1  CG10173-RA (Best2), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_137133.2  CG10143-RA (Adgf-E), mRNA 
0   NM_142043.1  CG9637-RA (Task6), mRNA 
0   NM_132701.2  CG11092-RA (CG11092), mRNA 
0   NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   NM_206263.1  CG11505-RC, transcript variant C (CG11505), mRNA 
0   NM_136145.1  CG13078-RA (CG13078), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_132955.1  CG4937-RA, transcript variant A (RhoGAP15B), mRNA 
0   NM_001042817.1  CG4937-RB, transcript variant B (RhoGAP15B), mRNA 
0   NM_140680.1  CG13022-RA (CG13022), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_206441.1  CG31481-RB, transcript variant B (pb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.