National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17753R-2 
 Symbol CCS  Full Name CCS 
 CG No CG17753  Old CG No CG17753 
 Synonyms CG17753, CCD, l(2)03221, anon-EST:Posey231, CCS 
 Accession No (Link to NCBI) NM_143772.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGAGGTGACGAATCCTATGCCGGTGCCCTCCGTTCGGCGCTGGATGGGGTCGGCCAGGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAAATTGACACCCAGGAAGGTCGAGTGATAATCCAAACCCAACGACCTTGGTCAGAGAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     121 TCAGGACAAGATAGAAGCCACAGGTGTCCGGGCCGTACTCTCCGGATTCGGCGGCCAGTC 180

                           ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCGGTGGCCCTTATAAACACAACAGGAAGTGTAGTGGACAAGACACCAATCCAGGGAGT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTTCGGTTTACCACCATTACCGCAGACAAGAAGCCTGGAGTGGTTGTGGATGGCGTTGT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGACGGTCTATCGCCTGGACTGCACGGATTACATATTCACGAGAGTGGTGACACTTCCGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGTTGCTCGTCGGTCGGAGAACACTACAATCCCCGCCAGTCGCCACATGGAAGCCCTGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCTGGGGCAGAGGAGCGGCACGCCGGAGATCTTGGCAACATCCGAGCGGATGAAAACGG 480

17753R-2.IR_full       481 CAGGGCCACCTTTAGATTTG 500
                           |||||||||||||||||||| silico     481 CAGGGCCACCTTTAGATTTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143772.3  CG17753-RA (CCS), mRNA 
0   NM_079997.2  CG13580-RA (Crtp), mRNA 
0   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_141151.2  CG11370-RA (CG11370), mRNA 
0   NM_166909.2  CG14814-RA, transcript variant A (CG14814), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 
0   NM_141158.3  CG7369-RA (CG7369), mRNA 
0   NM_140596.1  CG13071-RA (CG13071), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   10  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_168270.1  CG32356-RB, transcript variant B (ImpE1), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_135123.2  CG9021-RA (CG9021), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_168162.1  CG10173-RA (Best2), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_137133.2  CG10143-RA (Adgf-E), mRNA 
0   NM_142043.1  CG9637-RA (Task6), mRNA 
0   NM_132701.2  CG11092-RA (CG11092), mRNA 
0   NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   NM_206263.1  CG11505-RC, transcript variant C (CG11505), mRNA 
0   NM_136145.1  CG13078-RA (CG13078), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_132955.1  CG4937-RA, transcript variant A (RhoGAP15B), mRNA 
0   NM_001042817.1  CG4937-RB, transcript variant B (RhoGAP15B), mRNA 
0   NM_140680.1  CG13022-RA (CG13022), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_206441.1  CG31481-RB, transcript variant B (pb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.