National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1773R-2 
 Symbol CG1773  Full Name CG1773 
 CG No CG1773  Old CG No CG1773 
 Synonyms SP74, CG1773 
 Accession No (Link to NCBI) NM_136668.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGAACAGTCCTCTCGGGATCACTGCCCTAATTTGGGGCATTCTCTGCCTTAGCTGTCCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCTTCTTCTCAAGCCGGAAGGGAAGATTGGACACCACACGAGCTTCTGGCTTACGAACAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTGACACAACAGGATTGCGGTGTCCTATCGAATCTGATTCCCGCCCAAAGGCTTCGACGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGGATCACCGGCGGCAGGAAATCTTCGCTGTTGTCCCAGCCTTGGATGGCTTTTCTCCAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTTCCGGTGATATAGAGATGTGCCGCTGTGGAGGCTCTCTTCTCTCAGAACTCTTTGTT 300

                          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGACTGCC-GCGCACTGCTTCAAAATGTGTCCCCGATCTAAGGAGATAAGAGTGTGGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGGAGAGCTCGACATTAGTTCCACAAGTGACTGCGTCACCTACAATTATCAACGGGTTTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCACTGCCCGTGGAGGAGTTTACCATCGACAAGTGGATTCTTCACGAGGAGTTTAACCT 480

                          |||||||||||||||||||||||||| silico     481 CTTCTATCCCGGGTATGATATTGCTC 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   487  NM_136668.2  CG1773-RA (CG1773), mRNA 
21.76   106  124  97  47  NM_165691.2  CG30002-RA (CG30002), mRNA 
0   NM_142222.1  CG5302-RA (CG5302), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_206133.1  CG33459-RA (CG33459), mRNA 
0   NM_139854.1  CG8583-RA (sec63), mRNA 
0   NM_139880.2  CG7526-RA, transcript variant A (CG7526), mRNA 
0   NM_206292.1  CG7526-RB, transcript variant B (CG7526), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_079729.2  CG4792-RA (Dcr-1), mRNA 
0   NM_140319.1  CG10616-RA (CG10616), mRNA 
0   NM_139851.1  CG14834-RA (CG14834), mRNA 
0   NM_170040.2  CG31139-RA (CG31139), mRNA 
0   NM_140714.3  CG6456-RA (Mip), mRNA 
0   NM_138008.3  CG13565-RA (CG13565), mRNA 
0   NM_139531.3  CG32269-RA, transcript variant A (CG32269), mRNA 
0   NM_168003.2  CG32270-RA, transcript variant A (CG32270), mRNA 
0   NM_136943.1  CG8550-RA (CG8550), mRNA 
0   NM_136435.2  CG30502-RA (CG30502), mRNA 
0   NM_080121.2  CG7719-RA (gwl), mRNA 
0   NM_078590.2  CG1771-RB, transcript variant B (mew), mRNA 
0   NM_167354.1  CG1771-RA, transcript variant A (mew), mRNA 
0   NM_057219.3  CG9042-RA, transcript variant A (Gpdh), mRNA 
0   NM_057218.3  CG9042-RC, transcript variant C (Gpdh), mRNA 
0   NM_057217.3  CG9042-RB, transcript variant B (Gpdh), mRNA 
0   NM_166186.2  CG18471-RA (gprs), mRNA 
0   NM_132702.2  CG11063-RB (CG11063), mRNA 
0   NM_140363.2  CG11261-RA (CG11261), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.