National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1773R-1 
 Symbol CG1773  Full Name CG1773 
 CG No CG1773  Old CG No CG1773 
 Synonyms SP74, CG1773 
 Accession No (Link to NCBI) NM_136668.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fan W, Lam SM, Xin J, Yang X, Liu Z, Liu Y, Wang Y, Shui G, Huang X.
Drosophila TRF2 and TAF9 regulate lipid droplet size and phospholipid fatty acid composition.
PLoS Genet. (2017) 13(3) e1006664 [ PubMed ID = 28273089 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAACAGTCCTCTCGGGATC 
 Primer Seq. 3'
aatctagaggtaccGAGCAATATCATACCCGGGAT 
 Predicted Fragment Size
505 
 IR fragment full Seq
0001 ATGAACAGTC CTCTCGGGAT CACTGCCCTA ATTTGGGGCA TTCTCTGCCT TAGCTGTCCA 
0061 CCTTCTTCTC AAGCCGGAAG GGAAGATTGG ACACCACACG AGCTTCTGGC TTACGAACAG 
0121 TTGACACAAC AGGATTGCGG TGTCCTATCG AATCTGATTC CCGCCCAAAG GCTTCGACGG 
0181 CGGATCACCG GCGGCAGGAA ATCTTCGCTG TTGTCCCAGC CTTGGATGGC TTTTCTCCAC 
0241 ATTTCCGGTG ATATAGAGAT GTGCCGCTGT GGAGGCTCTC TTCTCTCAGA ACTCTTTGTT 
0301 TTGACTGCCN GCGCACTGCT TCAAAATGTG TCCCCGATCT AAGGAGATAA GAGTGTGGCT 
0361 GGGAGAGCTC GACATTAGTT CCACAAGTGA CTGCGTCACC TACAATTATC AACGGGTTTG 
0421 CGCACTGCCC GTGGAGGAGT TTACCATCGA CAAGTGGATT CTTCACGAGG AGTTTAACCT 
0481 CTTCTATCCC GGGTATGATA TTGCTC 
 in silico PCR Fragment
0001 ATGAACAGTC CTCTCGGGAT CACTGCCCTA ATTTGGGGCA TTCTCTGCCT TAGCTGTCCA 
0061 CCTTCTTCTC AAGCCGGAAG GGAAGATTGG ACACCACACG AGCTTCTGGC TTACGAACAG 
0121 TTGACACAAC AGGATTGCGG TGTCCTATCG AATCTGATTC CCGCCCAAAG GCTTCGACGG 
0181 CGGATCACCG GCGGCAGGAA ATCTTCGCTG TTGTCCCAGC CTTGGATGGC TTTTCTCCAC 
0241 ATTTCCGGTG ATATAGAGAT GTGCCGCTGT GGAGGCTCTC TTCTCTCAGA ACTCTTTGTT 
0301 TTGACTGCC- GCGCACTGCT TCAAAATGTG TCCCCGATCT AAGGAGATAA GAGTGTGGCT 
0361 GGGAGAGCTC GACATTAGTT CCACAAGTGA CTGCGTCACC TACAATTATC AACGGGTTTG 
0421 CGCACTGCCC GTGGAGGAGT TTACCATCGA CAAGTGGATT CTTCACGAGG AGTTTAACCT 
0481 CTTCTATCCC GGGTATGATA TTGCTC 
 Assemble Data

1773R-1.IR_full       1   ATGAACAGTCCTCTCGGGATCACTGCCCTAATTTGGGGCATTCTCTGCCTTAGCTGTCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     1   ATGAACAGTCCTCTCGGGATCACTGCCCTAATTTGGGGCATTCTCTGCCTTAGCTGTCCA 60


1773R-1.IR_full       61  CCTTCTTCTCAAGCCGGAAGGGAAGATTGGACACCACACGAGCTTCTGGCTTACGAACAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     61  CCTTCTTCTCAAGCCGGAAGGGAAGATTGGACACCACACGAGCTTCTGGCTTACGAACAG 120


1773R-1.IR_full       121 TTGACACAACAGGATTGCGGTGTCCTATCGAATCTGATTCCCGCCCAAAGGCTTCGACGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     121 TTGACACAACAGGATTGCGGTGTCCTATCGAATCTGATTCCCGCCCAAAGGCTTCGACGG 180


1773R-1.IR_full       181 CGGATCACCGGCGGCAGGAAATCTTCGCTGTTGTCCCAGCCTTGGATGGCTTTTCTCCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     181 CGGATCACCGGCGGCAGGAAATCTTCGCTGTTGTCCCAGCCTTGGATGGCTTTTCTCCAC 240


1773R-1.IR_full       241 ATTTCCGGTGATATAGAGATGTGCCGCTGTGGAGGCTCTCTTCTCTCAGAACTCTTTGTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     241 ATTTCCGGTGATATAGAGATGTGCCGCTGTGGAGGCTCTCTTCTCTCAGAACTCTTTGTT 300


1773R-1.IR_full       301 TTGACTGCCNGCGCACTGCTTCAAAATGTGTCCCCGATCTAAGGAGATAAGAGTGTGGCT 360
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     301 TTGACTGCC-GCGCACTGCTTCAAAATGTGTCCCCGATCTAAGGAGATAAGAGTGTGGCT 360


1773R-1.IR_full       361 GGGAGAGCTCGACATTAGTTCCACAAGTGACTGCGTCACCTACAATTATCAACGGGTTTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     361 GGGAGAGCTCGACATTAGTTCCACAAGTGACTGCGTCACCTACAATTATCAACGGGTTTG 420


1773R-1.IR_full       421 CGCACTGCCCGTGGAGGAGTTTACCATCGACAAGTGGATTCTTCACGAGGAGTTTAACCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1773R-1.in silico     421 CGCACTGCCCGTGGAGGAGTTTACCATCGACAAGTGGATTCTTCACGAGGAGTTTAACCT 480


1773R-1.IR_full       481 CTTCTATCCCGGGTATGATATTGCTC 506
                          ||||||||||||||||||||||||||
1773R-1.in silico     481 CTTCTATCCCGGGTATGATATTGCTC 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   487  NM_136668.2  CG1773-RA (CG1773), mRNA 
21.76   106  124  97  47  NM_165691.2  CG30002-RA (CG30002), mRNA 
0   NM_142222.1  CG5302-RA (CG5302), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_206133.1  CG33459-RA (CG33459), mRNA 
0   NM_139854.1  CG8583-RA (sec63), mRNA 
0   NM_139880.2  CG7526-RA, transcript variant A (CG7526), mRNA 
0   NM_206292.1  CG7526-RB, transcript variant B (CG7526), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_079729.2  CG4792-RA (Dcr-1), mRNA 
0   NM_140319.1  CG10616-RA (CG10616), mRNA 
0   NM_139851.1  CG14834-RA (CG14834), mRNA 
0   NM_170040.2  CG31139-RA (CG31139), mRNA 
0   NM_140714.3  CG6456-RA (Mip), mRNA 
0   NM_138008.3  CG13565-RA (CG13565), mRNA 
0   NM_139531.3  CG32269-RA, transcript variant A (CG32269), mRNA 
0   NM_168003.2  CG32270-RA, transcript variant A (CG32270), mRNA 
0   NM_136943.1  CG8550-RA (CG8550), mRNA 
0   NM_136435.2  CG30502-RA (CG30502), mRNA 
0   NM_080121.2  CG7719-RA (gwl), mRNA 
0   NM_078590.2  CG1771-RB, transcript variant B (mew), mRNA 
0   NM_167354.1  CG1771-RA, transcript variant A (mew), mRNA 
0   NM_057219.3  CG9042-RA, transcript variant A (Gpdh), mRNA 
0   NM_057218.3  CG9042-RC, transcript variant C (Gpdh), mRNA 
0   NM_057217.3  CG9042-RB, transcript variant B (Gpdh), mRNA 
0   NM_166186.2  CG18471-RA (gprs), mRNA 
0   NM_132702.2  CG11063-RB (CG11063), mRNA 
0   NM_140363.2  CG11261-RA (CG11261), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.