National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17712R-2 
 Symbol CG17712  Full Name CG17712 
 CG No CG17712  Old CG No CG17712 
 Synonyms BcDNA:GH03377, CG17712 
 Accession No (Link to NCBI) NM_134775.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAG-TGTTCGGAACGGGAGAGATAGCCAATGTGCTGGTGCCGCTGCTGCGGGAGAAAGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCGAGGTGCGGGCCATTTGGGGCAGGACCCTGAAAGAGGCGAAAGAGACTGCGACCACG 120

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGAATGTACAATTCCATACGAACGTAATCGACGATGTCCTGCTGCGGAAGGATGTGGAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGGTGTTCATCGTGTGCCAGCCCTTTCTGCACGCGGAGATCTCGGTGAAGGCCTTGGGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCGGGAAGCATGTGGTGTGCGACAAGCCAGCAGGATTGCACCAGCAGGACGCACTCAAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATGGTTCGGGCTTCTCAGTACTATCCCACTCTGATTTCCCTGGTCAATCACCCGCTGAGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTCCTGCCCGCCTTTACACATATGCGTCGTTGTCTGCAGGAGGAGCTAATTGGCTCTATT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCGACGTGGTACTCATGGATGTGCGCGTCCAGATGGGAACGCTCTTTCCCGAGAAGTAC 480

                           ||||||| |||||||||||||||||| silico     481 AACTGGA-TGTGCGATGCGCAAATGG 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   486  NM_134775.2  CG17712-RA (CG17712), mRNA 
0   NM_164534.1  CG3277-RA, transcript variant A (CG3277), mRNA 
0   NM_134918.2  CG3277-RB, transcript variant B (CG3277), mRNA 
0   NM_140351.2  CG11010-RA (Ent3), mRNA 
0   12  NM_057552.2  CG1454-RA (wdn), mRNA 
0   NM_134559.1  CG1829-RA (Cyp6v1), mRNA 
0   20  NM_132114.1  CG14442-RA (CG14442), mRNA 
0   34  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   34  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_168692.2  CG32170-RA (CG32170), mRNA 
0   NM_144366.2  CG6653-RA (Ugt86De), mRNA 
0   18  NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_168970.2  CG8385-RA, transcript variant A (Arf79F), mRNA 
0   NM_168972.1  CG8385-RD, transcript variant D (Arf79F), mRNA 
0   NM_057607.4  CG8385-RB, transcript variant B (Arf79F), mRNA 
0   NM_168973.2  CG8385-RE, transcript variant E (Arf79F), mRNA 
0   NM_168971.2  CG8385-RC, transcript variant C (Arf79F), mRNA 
0   51  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   29  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   13  NM_132636.2  CG12723-RA (CG12723), mRNA 
0   10  NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_001043056.1  CG17800-RW, transcript variant W (Dscam), mRNA 
0   NM_169454.1  CG4795-RA, transcript variant A (Cpn), mRNA 
0   NM_169455.1  CG4795-RB, transcript variant B (Cpn), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   153  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.