National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17712R-1 
 Symbol CG17712  Full Name CG17712 
 CG No CG17712  Old CG No CG17712 
 Synonyms BcDNA:GH03377, CG17712 
 Accession No (Link to NCBI) NM_134775.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGTGTTCGGAACGGGAGAGA 
 Primer Seq. 3'
aatctagaggtaccCCATTTGCGCATCGCACATCC 
 Predicted Fragment Size
504 
 IR fragment full Seq
0001 GAGTTGTTCG GAACGGGAGA GATAGCCAAT GTGCTGGTGC CGCTGCTGCG GGAGAAAGGA 
0061 TTCGAGGTGC GGGCCATTTG GGGCAGGACC CTGAAAGAGG CGAAAGAGAC TGCGACCACG 
0121 CAGAATGTCC AATTCCATAC GAACGTAATC GACGATGTCC TGCTGCGGAA GGATGTGGAT 
0181 CTGGTGTTCA TCGTGTGCCA GCCCTTTCTG CACGCGGAGA TCTCGGTGAA GGCCTTGGGC 
0241 ATCGGGAAGC ATGTGGTGTG CGACAAGCCA GCAGGATTGC ACCAGCAGGA CGCACTCAAA 
0301 ATGGTTCGGG CTTCTCAGTA CTATCCCACT CTGATTTCCC TGGTCAATCA CCCGCTGAGG 
0361 TTCCTGCCCG CCTTTACACA TATGCGTCGT TGTCTGCAGG AGGAGCTAAT TGGCTCTATT 
0421 GGCGACGTGG TACTCATGGA TGTGCGCGTC CAGATGGGAA CGCTCTTTCC CGAGAAGTAC 
0481 AACTGGACTG TGCGATGCGC AAATGG 
 in silico PCR Fragment
0001 GAG-TGTTCG GAACGGGAGA GATAGCCAAT GTGCTGGTGC CGCTGCTGCG GGAGAAAGGA 
0061 TTCGAGGTGC GGGCCATTTG GGGCAGGACC CTGAAAGAGG CGAAAGAGAC TGCGACCACG 
0121 CAGAATGTAC AATTCCATAC GAACGTAATC GACGATGTCC TGCTGCGGAA GGATGTGGAT 
0181 CTGGTGTTCA TCGTGTGCCA GCCCTTTCTG CACGCGGAGA TCTCGGTGAA GGCCTTGGGC 
0241 ATCGGGAAGC ATGTGGTGTG CGACAAGCCA GCAGGATTGC ACCAGCAGGA CGCACTCAAA 
0301 ATGGTTCGGG CTTCTCAGTA CTATCCCACT CTGATTTCCC TGGTCAATCA CCCGCTGAGG 
0361 TTCCTGCCCG CCTTTACACA TATGCGTCGT TGTCTGCAGG AGGAGCTAAT TGGCTCTATT 
0421 GGCGACGTGG TACTCATGGA TGTGCGCGTC CAGATGGGAA CGCTCTTTCC CGAGAAGTAC 
0481 AACTGGA-TG TGCGATGCGC AAATGG 
 Assemble Data

17712R-1.IR_full       1   GAGTTGTTCGGAACGGGAGAGATAGCCAATGTGCTGGTGCCGCTGCTGCGGGAGAAAGGA 60
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     1   GAG-TGTTCGGAACGGGAGAGATAGCCAATGTGCTGGTGCCGCTGCTGCGGGAGAAAGGA 60


17712R-1.IR_full       61  TTCGAGGTGCGGGCCATTTGGGGCAGGACCCTGAAAGAGGCGAAAGAGACTGCGACCACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     61  TTCGAGGTGCGGGCCATTTGGGGCAGGACCCTGAAAGAGGCGAAAGAGACTGCGACCACG 120


17712R-1.IR_full       121 CAGAATGTCCAATTCCATACGAACGTAATCGACGATGTCCTGCTGCGGAAGGATGTGGAT 180
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     121 CAGAATGTACAATTCCATACGAACGTAATCGACGATGTCCTGCTGCGGAAGGATGTGGAT 180


17712R-1.IR_full       181 CTGGTGTTCATCGTGTGCCAGCCCTTTCTGCACGCGGAGATCTCGGTGAAGGCCTTGGGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     181 CTGGTGTTCATCGTGTGCCAGCCCTTTCTGCACGCGGAGATCTCGGTGAAGGCCTTGGGC 240


17712R-1.IR_full       241 ATCGGGAAGCATGTGGTGTGCGACAAGCCAGCAGGATTGCACCAGCAGGACGCACTCAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     241 ATCGGGAAGCATGTGGTGTGCGACAAGCCAGCAGGATTGCACCAGCAGGACGCACTCAAA 300


17712R-1.IR_full       301 ATGGTTCGGGCTTCTCAGTACTATCCCACTCTGATTTCCCTGGTCAATCACCCGCTGAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     301 ATGGTTCGGGCTTCTCAGTACTATCCCACTCTGATTTCCCTGGTCAATCACCCGCTGAGG 360


17712R-1.IR_full       361 TTCCTGCCCGCCTTTACACATATGCGTCGTTGTCTGCAGGAGGAGCTAATTGGCTCTATT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     361 TTCCTGCCCGCCTTTACACATATGCGTCGTTGTCTGCAGGAGGAGCTAATTGGCTCTATT 420


17712R-1.IR_full       421 GGCGACGTGGTACTCATGGATGTGCGCGTCCAGATGGGAACGCTCTTTCCCGAGAAGTAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17712R-1.in silico     421 GGCGACGTGGTACTCATGGATGTGCGCGTCCAGATGGGAACGCTCTTTCCCGAGAAGTAC 480


17712R-1.IR_full       481 AACTGGACTGTGCGATGCGCAAATGG 506
                           ||||||| ||||||||||||||||||
17712R-1.in silico     481 AACTGGA-TGTGCGATGCGCAAATGG 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   486  NM_134775.2  CG17712-RA (CG17712), mRNA 
0   NM_164534.1  CG3277-RA, transcript variant A (CG3277), mRNA 
0   NM_134918.2  CG3277-RB, transcript variant B (CG3277), mRNA 
0   NM_140351.2  CG11010-RA (Ent3), mRNA 
0   12  NM_057552.2  CG1454-RA (wdn), mRNA 
0   NM_134559.1  CG1829-RA (Cyp6v1), mRNA 
0   20  NM_132114.1  CG14442-RA (CG14442), mRNA 
0   34  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   34  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_168692.2  CG32170-RA (CG32170), mRNA 
0   NM_144366.2  CG6653-RA (Ugt86De), mRNA 
0   18  NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_168970.2  CG8385-RA, transcript variant A (Arf79F), mRNA 
0   NM_168972.1  CG8385-RD, transcript variant D (Arf79F), mRNA 
0   NM_057607.4  CG8385-RB, transcript variant B (Arf79F), mRNA 
0   NM_168973.2  CG8385-RE, transcript variant E (Arf79F), mRNA 
0   NM_168971.2  CG8385-RC, transcript variant C (Arf79F), mRNA 
0   51  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   29  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   13  NM_132636.2  CG12723-RA (CG12723), mRNA 
0   10  NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_001043056.1  CG17800-RW, transcript variant W (Dscam), mRNA 
0   NM_169454.1  CG4795-RA, transcript variant A (Cpn), mRNA 
0   NM_169455.1  CG4795-RB, transcript variant B (Cpn), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   153  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.