National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17707R-2 
 Symbol CG17707  Full Name CG17707 
 CG No CG17707  Old CG No CG17707 
 Synonyms EG:23E12.3, CG17707, FBgn0025835 
 Accession No (Link to NCBI) NM_001103387 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zoolog Sci (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCGTGTTGGCTGTCCTAAT 
 Primer Seq. 3'
aatctagaggtaccACGTTCCCGACAAAGTTGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCGTGTTG GCTGTCCTAA TGCTCAACTT CAATTGTGTC AGCAAGTGCT CGAATGAGAC 
0061 CAAAAAACTT GAACCAGCCC CCTTGGCAGG ACATCGGCTT GTTAGCAGGG ATGGCAACAC 
0121 CACCATTCTG CATGAAGTGC AGAAAACGGA AACAGAGTTA CCGCTATTTT TAAACACTCA 
0181 CGAGATCCTG CCGCTCAAGC CGCTAAAGAA GAAACCTTAT TTGCCCCTGG AGAAGATAAT 
0241 GCCGACCATT GAGTATGTAA AGCCACCACA ACCACTGAAG GAGTTCGAAC TGCATCCGGT 
0301 TACCTTTGAC TTCAATTTGG GAGATTTAGA GGATTTGGAA CACGAGGTTA TTAAGAAGGG 
0361 TGATCTGAAC AATCAGAATC AGCATGTCCT GACCTTGGAC ACTAGCTACA ATCCCTCAAA 
0421 TCCCGATGAG AACGATACTG TGGATATACA CATCGCCGAG TTTTCCACAG AGCCCAACAC 
0481 AGCAACTTTG TCGGGAACGT  
 in silico PCR Fragment
0001 AGCCGTGTTG GCTGTCCTAA TGCTCAACTT CAATTGTGTC AGCAAGTGCT CGAATGAGAC 
0061 CAAAAAACTT GAACCAGCCC CCTTGGCAGG ACATCGGCTT GTTAGCAGGG ATGGCAACAC 
0121 CACCATTCTG CATGAAGTGC AGAAAACGGA AACAGAGTTA CCGCTATTTT TAAACACTCA 
0181 CGAGATCCTG CCGCTCAAGC CGCTAAAGAA GAAACCTTAT TTGCCCCTGG AGAAGATAAT 
0241 GCCGACCATT GAGTATGTAA AGCCACCACA ACCACTGAAG GAGTTCGAAC TGCATCCGGT 
0301 TACCTTTGAC TTCAATTTGG GAGATTTAGA GGATTTGGAA CACGAGGTTA TTAAGAAGGG 
0361 TGATCTGAAC AATCAGAATC AGCATGTCCT GACCTTGGAC ACTAGCTACA ATCCCTCAAA 
0421 TCCCGATGAG AACGATACTG TGGATATACA CATCGCCGAG TTTTCCACAG AGCCCAACAC 
0481 AGCAACTTTG TCGGGAACGT  
 Assemble Data

17707R-2.IR_full       1   AGCCGTGTTGGCTGTCCTAATGCTCAACTTCAATTGTGTCAGCAAGTGCTCGAATGAGAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     1   AGCCGTGTTGGCTGTCCTAATGCTCAACTTCAATTGTGTCAGCAAGTGCTCGAATGAGAC 60


17707R-2.IR_full       61  CAAAAAACTTGAACCAGCCCCCTTGGCAGGACATCGGCTTGTTAGCAGGGATGGCAACAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     61  CAAAAAACTTGAACCAGCCCCCTTGGCAGGACATCGGCTTGTTAGCAGGGATGGCAACAC 120


17707R-2.IR_full       121 CACCATTCTGCATGAAGTGCAGAAAACGGAAACAGAGTTACCGCTATTTTTAAACACTCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     121 CACCATTCTGCATGAAGTGCAGAAAACGGAAACAGAGTTACCGCTATTTTTAAACACTCA 180


17707R-2.IR_full       181 CGAGATCCTGCCGCTCAAGCCGCTAAAGAAGAAACCTTATTTGCCCCTGGAGAAGATAAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     181 CGAGATCCTGCCGCTCAAGCCGCTAAAGAAGAAACCTTATTTGCCCCTGGAGAAGATAAT 240


17707R-2.IR_full       241 GCCGACCATTGAGTATGTAAAGCCACCACAACCACTGAAGGAGTTCGAACTGCATCCGGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     241 GCCGACCATTGAGTATGTAAAGCCACCACAACCACTGAAGGAGTTCGAACTGCATCCGGT 300


17707R-2.IR_full       301 TACCTTTGACTTCAATTTGGGAGATTTAGAGGATTTGGAACACGAGGTTATTAAGAAGGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     301 TACCTTTGACTTCAATTTGGGAGATTTAGAGGATTTGGAACACGAGGTTATTAAGAAGGG 360


17707R-2.IR_full       361 TGATCTGAACAATCAGAATCAGCATGTCCTGACCTTGGACACTAGCTACAATCCCTCAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     361 TGATCTGAACAATCAGAATCAGCATGTCCTGACCTTGGACACTAGCTACAATCCCTCAAA 420


17707R-2.IR_full       421 TCCCGATGAGAACGATACTGTGGATATACACATCGCCGAGTTTTCCACAGAGCCCAACAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17707R-2.in silico     421 TCCCGATGAGAACGATACTGTGGATATACACATCGCCGAGTTTTCCACAGAGCCCAACAC 480


17707R-2.IR_full       481 AGCAACTTTGTCGGGAACGT 500
                           ||||||||||||||||||||
17707R-2.in silico     481 AGCAACTTTGTCGGGAACGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.