National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1768R-3 
 Symbol dia  Full Name diaphanous 
 CG No CG1768  Old CG No CG1768 
 Synonyms Dia, 38E.16, CG1768, l(2)k07135, ms(2)04138, dia 
 Accession No (Link to NCBI) NM_057633.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Roy S, Huang H, Liu S, Kornberg TB.
Cytoneme-mediated contact-dependent transport of the Drosophila decapentaplegic signaling protein.
Science (2014) 343(6173) 1244624 [ PubMed ID = 24385607 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGGGAGGAACCATCAGCAG 
 Primer Seq. 3'
aatctagaggtaccGGCACCGAATCGCCTCGAACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAgGGAGGA ACCATCAGCA GTGGCACCCT GGCCCATgGN GGACGACCCG TGTCCGCGGA 
0061 CAACTATGTG GTGCCGGGCG TGGAGGACTT TGAGCAGTAC ATCCAGCAGC TAAGCGTTGC 
0121 GGAGCTGNGA TGCGAAGTTT CTGGAGATCA TCGAGGACAT GAACATTCCG AAGGACAAGA 
0181 GGGAGCCCCT GTTGGCCAAA TCGAAGGAGG AGCGACAGAA GATGATTATG TGGCACTTGA 
0241 AAGGTAAAAA CTCACTGGAG CGTAGCGCCA ACTCCCGCTT CGAGAAGCCC ATAGACTATG 
0301 TGGAATACCT GCAGAATGGG GAGCACAGCA CGCACAAGGT GTACCAATGT GTGGAATCTC 
0361 TGCGCGTGGC GCTCNACCAG CAATCCGATC TCGTGGATCA AGGAGTTTGG AGTGGCGGGC 
0421 ATCGGGACGA TTGAGAAGCT GCTGGCCCGG TCAAAGAATA ATGCCAGCTA CGAGAAGATC 
0481 GAGTTCGAGG CGATTCGGTN CC 
 in silico PCR Fragment
0001 CAAGGGAGGA ACCATCAGCA GTGGCACCCT GGCCCATGGC GGACGACCCG TGTCCGCGGA 
0061 CAACTATGTG GTGCCGGGCG TGGAGGACTT TGAGCAGTAC ATCCAGCAGC TAAGCGTTGC 
0121 GGAGCTG-GA TGCGAAGTTT CTGGAGATCA TCGAGGACAT GAACATTCCG AAGGACAAGA 
0181 GGGAGCCCCT GTTGGCCAAA TCGAAGGAGG AGCGACAGAA GATGATTATG TGGCACTTGA 
0241 AAGGTAAAAA CTCACTGGAG CGTAGCGCCA ACTCCCGCTT CGAGAAGCCC ATAGACTATG 
0301 TGGAATACCT GCAGAATGGG GAGCACAGCA CGCACAAGGT GTACCAATGT GTGGAATCTC 
0361 TGCGCGTGGC GCTC-ACCAG CAATCCGATC TCGTGGATCA AGGAGTTTGG AGTGGCGGGC 
0421 ATCGGGACGA TTGAGAAGCT GCTGGCCCGG TCAAAGAATA ATGCCAGCTA CGAGAAGATC 
0481 GAGTTCGAGG CGATTCGGTG CC 
 Assemble Data

1768R-3.IR_full       1   CAAGGGAGGAACCATCAGCAGTGGCACCCTGGCCCATGGNGGACGACCCGTGTCCGCGGA 60
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
1768R-3.in silico     1   CAAGGGAGGAACCATCAGCAGTGGCACCCTGGCCCATGGCGGACGACCCGTGTCCGCGGA 60


1768R-3.IR_full       61  CAACTATGTGGTGCCGGGCGTGGAGGACTTTGAGCAGTACATCCAGCAGCTAAGCGTTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     61  CAACTATGTGGTGCCGGGCGTGGAGGACTTTGAGCAGTACATCCAGCAGCTAAGCGTTGC 120


1768R-3.IR_full       121 GGAGCTGNGATGCGAAGTTTCTGGAGATCATCGAGGACATGAACATTCCGAAGGACAAGA 180
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     121 GGAGCTG-GATGCGAAGTTTCTGGAGATCATCGAGGACATGAACATTCCGAAGGACAAGA 180


1768R-3.IR_full       181 GGGAGCCCCTGTTGGCCAAATCGAAGGAGGAGCGACAGAAGATGATTATGTGGCACTTGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     181 GGGAGCCCCTGTTGGCCAAATCGAAGGAGGAGCGACAGAAGATGATTATGTGGCACTTGA 240


1768R-3.IR_full       241 AAGGTAAAAACTCACTGGAGCGTAGCGCCAACTCCCGCTTCGAGAAGCCCATAGACTATG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     241 AAGGTAAAAACTCACTGGAGCGTAGCGCCAACTCCCGCTTCGAGAAGCCCATAGACTATG 300


1768R-3.IR_full       301 TGGAATACCTGCAGAATGGGGAGCACAGCACGCACAAGGTGTACCAATGTGTGGAATCTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     301 TGGAATACCTGCAGAATGGGGAGCACAGCACGCACAAGGTGTACCAATGTGTGGAATCTC 360


1768R-3.IR_full       361 TGCGCGTGGCGCTCNACCAGCAATCCGATCTCGTGGATCAAGGAGTTTGGAGTGGCGGGC 420
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     361 TGCGCGTGGCGCTC-ACCAGCAATCCGATCTCGTGGATCAAGGAGTTTGGAGTGGCGGGC 420


1768R-3.IR_full       421 ATCGGGACGATTGAGAAGCTGCTGGCCCGGTCAAAGAATAATGCCAGCTACGAGAAGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1768R-3.in silico     421 ATCGGGACGATTGAGAAGCTGCTGGCCCGGTCAAAGAATAATGCCAGCTACGAGAAGATC 480


1768R-3.IR_full       481 GAGTTCGAGGCGATTCGGTNCC 502
                          ||||||||||||||||||| ||
1768R-3.in silico     481 GAGTTCGAGGCGATTCGGTGCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057633.3  CG1768-RA, transcript variant A (dia), mRNA 
100   482  NM_165341.1  CG1768-RB, transcript variant B (dia), mRNA 
0   11  NM_057953.3  CG3998-RA (zf30C), mRNA 
0   NM_176567.1  CG33102-RA (Hex-t1), mRNA 
0   NM_078547.2  CG2979-RA (Yp2), mRNA 
0   NM_139995.1  CG6511-RA (CG6511), mRNA 
0   NM_165549.2  CG1399-RA, transcript variant A (CG1399), mRNA 
0   NM_136472.3  CG1399-RB, transcript variant B (CG1399), mRNA 
0   NM_176511.1  CG31247-RC, transcript variant C (tinc), mRNA 
0   NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_139642.1  CG15019-RA (CG15019), mRNA 
0   NM_143281.1  CG6066-RA (CG6066), mRNA 
0   NM_137833.1  CG4610-RA (CG4610), mRNA 
0   NM_135361.2  CG7818-RA (CG7818), mRNA 
0   NM_058090.2  CG7121-RA (Tehao), mRNA 
0   NM_136385.2  CG3403-RA (CG3403), mRNA 
0   NM_132935.1  CG9606-RA (Rrp45), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_136756.2  CG11887-RA (StIP), mRNA 
0   NM_142608.2  CG4973-RA (CG4973), mRNA 
0   NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_140010.1  CG13313-RA (CG13313), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0   NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0   NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.