National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17676R-4 
 Symbol Snap25  Full Name Synapse protein 25 
 CG No CG40452  Old CG No CG17676 
 Synonyms SNAP-25, snap-25, SNAP25, snp25, CG17884, CG17676, CG40452, Snap25 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCAGCGGATCCATCTGAA 
 Primer Seq. 3'
aatctagaggtaccATCATAGTGTTTACCTGGCCC 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 NTGCCAGCGG ATCCATCTGA AGAAGTTGCC CCTCAGGTCC CGAAGACCGA GCTAGAAGAG 
0061 CTGCAAATTA ATGCGCAAGG AGTAGCCGAT GAGTCCCTGG AAAGTACGCG ACGTATGCTT 
0121 GCTCTGTGTG AGGAGAGCAA GGAGGCAGGG ATTCGAACAC TTGTAGCCCT TGATGATCAA 
0181 GGAGAACAAC TGGATCGTAT TGAAGAAGGA ATGGATCAAA TTAATGCAGA CATGAGAGAA 
0241 GCAGAAAAAA ATTTAAGTGG AATGGAAAAA TGTTGCGGCA TTTGTGTTCT TCCGTGCAAT 
0301 AAAAGTCAAT CATTCAAAGA AGATGATGGG ACCTGGAAAG GAAATGATGA CGGAAAAGTT 
0361 GTAAATAATC AGCCACAGAG AGTGATGGAT GATAGAAATG GCATGATGGC GCAAGCGGGT 
0421 TATATTGGCA GGATAACGAA CGACGCTAGA GAAGATGAAA TGGAAGAAAA TATGGGCCAG 
0481 GTAAACACTA TGAT 
 in silico PCR Fragment
0001 ATGCCAGCGG ATCCATCTGA AGAAGTTGCC CCTCAGGTCC CGAAGACCGA GCTAGAAGAG 
0061 CTGCAAATTA ATGCGCAAGG AGTAGCCGAT GAGTCCCTGG AAAGTACGCG ACGTATGCTT 
0121 GCTCTGTGTG AGGAGAGCAA GGAGGCAGGG ATTCGAACAC TTGTAGCCCT TGATGATCAA 
0181 GGAGAACAAC TGGATCGTAT TGAAGAAGGA ATGGATCAAA TTAATGCAGA CATGAGAGAA 
0241 GCAGAAAAAA ATTTAAGTGG AATGGAAAAA TGTTGCGGCA TTTGTGTTCT TCCGTGCAAT 
0301 AAAAGTCAAT CATTCAAAGA AGATGATGGG ACCTGGAAAG GAAATGATGA CGGAAAAGTT 
0361 GTAAATAATC AGCCACAGAG AGTGATGGAT GATAGAAATG GCATGATGGC GCAAGCGGGT 
0421 TATATTGGCA GGATAACGAA CGACGCTAGA GAAGATGAAA TGGAAGAAAA TATGGGCCAG 
0481 GTAAACACTA TGAT 
 Assemble Data

3635Ra-1.IR full       1   GCGCCCATAGCTTACATGCGTGACCACTCTTTTATTCTGTCCAAGCTGGGTGGCATTTTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     1   GCGCCCATAGCTTACATGCGTGACCACTCTTTTATTCTGTCCAAGCTGGGTGGCATTTTT 60


3635Ra-1.IR full       61  CTGGGAACGCCGTCCTTTCTTAGCTGGGTATTAGGAAGTATGGAGCTGCTACCTATTACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     61  CTGGGAACGCCGTCCTTTCTTAGCTGGGTATTAGGAAGTATGGAGCTGCTACCTATTACT 120


3635Ra-1.IR full       121 AATTTACAGAAACTGATATGTGAGCACATCTGTTCCAGTAGCTCCATGTTTAACTTTCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     121 AATTTACAGAAACTGATATGTGAGCACATCTGTTCCAGTAGCTCCATGTTTAACTTTCTG 180


3635Ra-1.IR full       181 TGCTCTGGTCTGCTGGACTTCATCGGAGGGTGGGGAACACGACACTTGAACCAGACTCTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     181 TGCTCTGGTCTGCTGGACTTCATCGGAGGGTGGGGAACACGACACTTGAACCAGACTCTG 240


3635Ra-1.IR full       241 TTGCCGGACGTTTGTGCAACACACCCAG-AGGGGCATCTTCGAGCCAAGTAATCCACTAC 300
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
3635Ra-1.in silico     241 TTGCCGGACGTTTGTGCAACACACCCAGCAGGGGCATCTTCGAGCCAAGTAATCCACTAC 300


3635Ra-1.IR full       301 CTCCAGCTTTACAGGTCAGGCGACTTCCGACAGTATGATCATGGACCGGAGCTAAACGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     301 CTCCAGCTTTACAGGTCAGGCGACTTCCGACAGTATGATCATGGACCGGAGCTAAACGAA 360


3635Ra-1.IR full       361 ATCATTTACCAGCAGCCAACGCCTCCATCTTACAACGTTCAATACATTAAGAGCTGTGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     361 ATCATTTACCAGCAGCCAACGCCTCCATCTTACAACGTTCAATACATTAAGAGCTGTGTG 420


3635Ra-1.IR full       421 GATATGTACTACAGCGAAAATGACTATATGTCCGCTGTTGGGGATGTGAAGTATCTGGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3635Ra-1.in silico     421 GATATGTACTACAGCGAAAATGACTATATGTCCGCTGTTGGGGATGTGAAGTATCTGGCC 480


3635Ra-1.IR full       481 TCACTCCTACCATGCGCCCA 500
                           ||||||||||||||||||||
3635Ra-1.in silico     481 TCACTCCTACCATGCGCCCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.