National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17676R-1 
 Symbol Snap25  Full Name Synapse protein 25 
 CG No CG40452  Old CG No CG17676 
 Synonyms SNAP-25, snap-25, SNAP25, snp25, CG17884, CG17676, CG40452, Snap25 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCAGCGGATCCATCTGAA 
 Primer Seq. 3'
aatctagaggtaccATCATAGTGTTTACCTGGCCC 
 Predicted Fragment Size
494 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

17676R-1.IR full        1   TGCCAGCGGATCCATCTGAAGAAGTTGCCCCTCAGGTCCCGAAGACCGAGCTAGAAGAG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico      1   TGCCAGCGGATCCATCTGAAGAAGTTGCCCCTCAGGTCCCGAAGACCGAGCTAGAAGAG 59


17676R-1.IR full       61  CTGCAAATTAATGCGCAAGGAGTAGCCGATGAGTCCCTGGAAAGTACGCGACGTATGCTT 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     61  CTGCAAATTAATGCGCAAGGAGTAGCCGATGAGTCCCTGGAAAGTACGCGACGTATGCTT 119


17676R-1.IR full       121 GCTCTGTGTGAGGAGAGCAAGGAGGCAGGGATTCGAACACTTGTAGCCCTTGATGATCAA 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     121 GCTCTGTGTGAGGAGAGCAAGGAGGCAGGGATTCGAACACTTGTAGCCCTTGATGATCAA 179


17676R-1.IR full       181 GGAGAACAACTGGATCGTATTGAAGAAGGAATGGATCAAATTAATGCAGACATGAGAGAA 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     181 GGAGAACAACTGGATCGTATTGAAGAAGGAATGGATCAAATTAATGCAGACATGAGAGAA 239


17676R-1.IR full       241 GCAGAAAAAAATTTAAGTGGAATGGAAAAATGTTGCGGCATTTGTGTTCTTCCGTGCAAT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     241 GCAGAAAAAAATTTAAGTGGAATGGAAAAATGTTGCGGCATTTGTGTTCTTCCGTGCAAT 299


17676R-1.IR full       301 AAAAGTCAATCATTCAAAGAAGATGATGGGACCTGGAAAGGAAATGATGACGGAAAAGTT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     301 AAAAGTCAATCATTCAAAGAAGATGATGGGACCTGGAAAGGAAATGATGACGGAAAAGTT 359


17676R-1.IR full       361 GTAAATAATCAGCCACAGAGAGTGATGGATGATAGAAATGGCATGATGGCGCAAGCGGGT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     361 GTAAATAATCAGCCACAGAGAGTGATGGATGATAGAAATGGCATGATGGCGCAAGCGGGT 419


17676R-1.IR full       421 TATATTGGCAGGATAACGAACGACGCTAGAGAAGATGAAATGGAAGAAAATATGGGCCAG 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17676R-1.in silico     421 TATATTGGCAGGATAACGAACGACGCTAGAGAAGATGAAATGGAAGAAAATATGGGCCAG 479


17676R-1.IR full       481 GTAAACACTATGAT 493
                           ||||||||||||||
17676R-1.in silico     481 GTAAACACTATGAT 493

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.