National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17633R-3 
 Symbol CG17633  Full Name CG17633 
 CG No CG17633  Old CG No CG17633 
 Synonyms CG17633 
 Accession No (Link to NCBI) NM_135466.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCAACTCGGAGAATGCCAAGC 
 Primer Seq. 3'
aatctagaggtaccGATGATAAAGGTGGCGGCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCAACTCGGA GAATGCCAAG CAGCTGGAGG TGCTGAAGGA CCTCGAGGGA TCCAGCGACT 
0061 CAATCATGTT CTTGGATGGC GTTCATCTGG TTGGTGCCGA TATTCAGATC ATCGTGGCTC 
0121 CCCACAAGGT GCCCGATTTC CTAGAGATCC TGGGCAAGTC TGAAATCAAG TATGAGCTGC 
0181 AGTCGCGCGA TGTGCAGAAG TCTCTGGACG AGATCGACGA GAAGGTCGCT ATCAAGGGAC 
0241 GTGCCACCAC CGCCTACAAC TGGGCCGAGT ACTACGAACT CGACGACACC TATGCCTGGC 
0301 NCCAGTCCCT GGCCCAGACG AATCCCGGAG TGGTCACCCT CATTGAGGGC GGCAAGACCT 
0361 ACCAGGGACG CTCCATCCTC GGTGTTAAGA TCACCAAGGG AGGTGAGACC ATAAACGGCA 
0421 AgGCCAAGCC CGGCATCTTC CTGGAGGCCG GTATCCATGC CCGCGAGTGG ATTGCTCCAG 
0481 CTGCCNGCCA CCTTTATCAT C 
 in silico PCR Fragment
0001 TCAACTCGGA GAATGCCAAG CAACTGGAGG TGCTGAAGGA TCTCGAGGGA TCCAGCGACT 
0061 CAATCATGTT CTTGGATGGC GTTCATCTGG TTGGTGCCGA TATTCAGATA ATCGTGGCTC 
0121 CCCACAAGGT GCCCGACTTC CTGGAGATTC TGGGCAAGTC TGAAATCAAG TATGAGCTGC 
0181 AATCGCGCGA TGTGCAAAAG TCTCTGGACG AGATCGACGA GAAGGTCGCT ATCAAGGGAC 
0241 GTGCCACCAC CGCCTACAAC TGGGCCCAGT ACTACGAACT CGACGACACC TATGCCTGGC 
0301 TCCAGTCCCT GGCCCAGACG AATCCCGGAG TGGTCACCCT CATTGAGGGC GGCAAGACCT 
0361 ACCAGGGACG CTCCATCCTC GGTGTTAAGA TCACCAAGGG AGGTGAGACC ATAAACGGCA 
0421 AGGCCAAGCC CGGCATCTTC CTGGAGGCCG GTATCCATGC CCGCGAGTGG ATTGCTCCAG 
0481 CTGCC-GCCA CCTTTATCAT C 
 Assemble Data

17633R-3.IR_full       1   TCAACTCGGAGAATGCCAAGCAGCTGGAGGTGCTGAAGGACCTCGAGGGATCCAGCGACT 60
                           |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||
17633R-3.in silico     1   TCAACTCGGAGAATGCCAAGCAACTGGAGGTGCTGAAGGATCTCGAGGGATCCAGCGACT 60


17633R-3.IR_full       61  CAATCATGTTCTTGGATGGCGTTCATCTGGTTGGTGCCGATATTCAGATCATCGTGGCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
17633R-3.in silico     61  CAATCATGTTCTTGGATGGCGTTCATCTGGTTGGTGCCGATATTCAGATAATCGTGGCTC 120


17633R-3.IR_full       121 CCCACAAGGTGCCCGATTTCCTAGAGATCCTGGGCAAGTCTGAAATCAAGTATGAGCTGC 180
                           |||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||
17633R-3.in silico     121 CCCACAAGGTGCCCGACTTCCTGGAGATTCTGGGCAAGTCTGAAATCAAGTATGAGCTGC 180


17633R-3.IR_full       181 AGTCGCGCGATGTGCAGAAGTCTCTGGACGAGATCGACGAGAAGGTCGCTATCAAGGGAC 240
                           | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
17633R-3.in silico     181 AATCGCGCGATGTGCAAAAGTCTCTGGACGAGATCGACGAGAAGGTCGCTATCAAGGGAC 240


17633R-3.IR_full       241 GTGCCACCACCGCCTACAACTGGGCCGAGTACTACGAACTCGACGACACCTATGCCTGGC 300
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
17633R-3.in silico     241 GTGCCACCACCGCCTACAACTGGGCCCAGTACTACGAACTCGACGACACCTATGCCTGGC 300


17633R-3.IR_full        301 CCAGTCCCTGGCCCAGACGAATCCCGGAGTGGTCACCCTCATTGAGGGCGGCAAGACCT 359
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17633R-3.in silico      301 CCAGTCCCTGGCCCAGACGAATCCCGGAGTGGTCACCCTCATTGAGGGCGGCAAGACCT 359


17633R-3.IR_full       361 ACCAGGGACGCTCCATCCTCGGTGTTAAGATCACCAAGGGAGGTGAGACCATAAACGGCA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17633R-3.in silico     361 ACCAGGGACGCTCCATCCTCGGTGTTAAGATCACCAAGGGAGGTGAGACCATAAACGGCA 419


17633R-3.IR_full       421 AGGCCAAGCCCGGCATCTTCCTGGAGGCCGGTATCCATGCCCGCGAGTGGATTGCTCCAG 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17633R-3.in silico     421 AGGCCAAGCCCGGCATCTTCCTGGAGGCCGGTATCCATGCCCGCGAGTGGATTGCTCCAG 479


17633R-3.IR_full       481 CTGCCNGCCACCTTTATCATC 500
                           ||||| |||||||||||||||
17633R-3.in silico     481 CTGCC-GCCACCTTTATCATC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135466.2  CG17633-RA (CG17633), mRNA 
0   NM_138222.2  CG12191-RA (dpr20), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 
0   NM_137885.2  CG3682-RA, transcript variant A (PIP5K59B), mRNA 
0   NM_166567.1  CG3682-RB, transcript variant B (PIP5K59B), mRNA 
0   NM_167558.1  CG32562-RA (xmas-2), mRNA 
0   NM_137689.2  CG3221-RA (CG3221), mRNA 
0   NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0   NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0   NM_136413.1  CG12836-RA (CG12836), mRNA 
0   NM_135967.1  CG13272-RA (CG13272), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_136587.1  CG8230-RA (CG8230), mRNA 
0   NM_138068.3  CG3483-RA (CG3483), mRNA 
0   NM_164711.1  CG9261-RD, transcript variant D (nrv2), mRNA 
0   NM_057821.3  CG9261-RA, transcript variant A (nrv2), mRNA 
0   NM_001014476.1  CG9261-RE, transcript variant E (nrv2), mRNA 
0   NM_168948.3  CG12673-RA (olf413), mRNA 
0   NM_001038757.1  CG9201-RC, transcript variant C (Grip128), mRNA 
0   NM_132802.2  CG9201-RB, transcript variant B (Grip128), mRNA 
0   14  NM_139863.3  CG8560-RA (CG8560), mRNA 
0   10  NM_142884.1  CG4408-RA (CG4408), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   NM_135746.2  CG5792-RA, transcript variant A (CG5792), mRNA 
0   NM_138013.2  CG16787-RA (CG16787), mRNA 
0   NM_165868.1  CG8857-RC, transcript variant C (RpS11), mRNA 
0   NM_136903.3  CG8857-RA, transcript variant A (RpS11), mRNA 
0   NM_142581.1  CG4562-RA (CG4562), mRNA 
0   NM_139803.2  CG14820-RA (CG14820), mRNA 
0   NM_168084.1  CG11347-RD, transcript variant D (CG11347), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.