National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17633R-3 
 Symbol CG17633  Full Name CG17633 
 CG No CG17633  Old CG No CG17633 
 Synonyms CG17633 
 Accession No (Link to NCBI) NM_135466.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| silico     1   TCAACTCGGAGAATGCCAAGCAACTGGAGGTGCTGAAGGATCTCGAGGGATCCAGCGACT 60

                           ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     61  CAATCATGTTCTTGGATGGCGTTCATCTGGTTGGTGCCGATATTCAGATAATCGTGGCTC 120

                           |||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| silico     121 CCCACAAGGTGCCCGACTTCCTGGAGATTCTGGGCAAGTCTGAAATCAAGTATGAGCTGC 180

                           | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     181 AATCGCGCGATGTGCAAAAGTCTCTGGACGAGATCGACGAGAAGGTCGCTATCAAGGGAC 240

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     241 GTGCCACCACCGCCTACAACTGGGCCCAGTACTACGAACTCGACGACACCTATGCCTGGC 300

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      301 CCAGTCCCTGGCCCAGACGAATCCCGGAGTGGTCACCCTCATTGAGGGCGGCAAGACCT 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACCAGGGACGCTCCATCCTCGGTGTTAAGATCACCAAGGGAGGTGAGACCATAAACGGCA 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGCCAAGCCCGGCATCTTCCTGGAGGCCGGTATCCATGCCCGCGAGTGGATTGCTCCAG 479

17633R-3.IR_full       481 CTGCCNGCCACCTTTATCATC 500
                           ||||| ||||||||||||||| silico     481 CTGCC-GCCACCTTTATCATC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135466.2  CG17633-RA (CG17633), mRNA 
0   NM_138222.2  CG12191-RA (dpr20), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 
0   NM_137885.2  CG3682-RA, transcript variant A (PIP5K59B), mRNA 
0   NM_166567.1  CG3682-RB, transcript variant B (PIP5K59B), mRNA 
0   NM_167558.1  CG32562-RA (xmas-2), mRNA 
0   NM_137689.2  CG3221-RA (CG3221), mRNA 
0   NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0   NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0   NM_136413.1  CG12836-RA (CG12836), mRNA 
0   NM_135967.1  CG13272-RA (CG13272), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_136587.1  CG8230-RA (CG8230), mRNA 
0   NM_138068.3  CG3483-RA (CG3483), mRNA 
0   NM_164711.1  CG9261-RD, transcript variant D (nrv2), mRNA 
0   NM_057821.3  CG9261-RA, transcript variant A (nrv2), mRNA 
0   NM_001014476.1  CG9261-RE, transcript variant E (nrv2), mRNA 
0   NM_168948.3  CG12673-RA (olf413), mRNA 
0   NM_001038757.1  CG9201-RC, transcript variant C (Grip128), mRNA 
0   NM_132802.2  CG9201-RB, transcript variant B (Grip128), mRNA 
0   14  NM_139863.3  CG8560-RA (CG8560), mRNA 
0   10  NM_142884.1  CG4408-RA (CG4408), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   NM_135746.2  CG5792-RA, transcript variant A (CG5792), mRNA 
0   NM_138013.2  CG16787-RA (CG16787), mRNA 
0   NM_165868.1  CG8857-RC, transcript variant C (RpS11), mRNA 
0   NM_136903.3  CG8857-RA, transcript variant A (RpS11), mRNA 
0   NM_142581.1  CG4562-RA (CG4562), mRNA 
0   NM_139803.2  CG14820-RA (CG14820), mRNA 
0   NM_168084.1  CG11347-RD, transcript variant D (CG11347), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.