National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17565R-2 
 Symbol CG17565  Full Name CG17565 
 CG No CG17565  Old CG No CG17565 
 Synonyms CG17565 
 Accession No (Link to NCBI) NM_142283.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Strutt H, Thomas-MacArthur V, Strutt D.
Strabismus promotes recruitment and degradation of farnesylated prickle in Drosophila melanogaster planar polarity specification.
PLoS Genet (2013) 9(7) e1003654 [ PubMed ID = 23874239 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGCTGATGTTCCGCAACT 
 Primer Seq. 3'
aatctagaggtaccTACACTGAACAGGAACTGGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGCTGAT GTTTCCGCAA CTTCCAGCGC CTGAAAAGCT ACATCTTCGA CGACGAGAAG 
0061 GTGTCCACCA CCACATCCCG CGAGCAACAA AAGACGGAGA GTTCGGTGGA GAAATGCTTC 
0121 GACCGCTTCG AGCAGATAAT GTTCACCGAC CCGCGCCTCA CCCAGATCTT CCGGCTGGAG 
0181 CACCAGTACT ACCTGGACGC GATGCTGAGG CGGCTGCCGT CCAATTACGA GTGCCTGGAC 
0241 AGCAGTCGCG CGTGGTGCGT TTACTGGATC CTGCAGGCGG CCCAGCTACT TAGCTTTAAC 
0301 TTCGACGACC AGACATTGAA CCACGTGGTC CAGTTTCTAA GCAACTGCCG TTCGCCGACT 
0361 GGGGGTTTTG GAGGAGGACC TGGACAGTAT GCCCATCTGG CGCCCACCTA TGCAGCAGTG 
0421 AACAGTCTGT GCATCATCGG AAGCGAGCAG GCGTACCGTG CCATAGACCG ACCGACTTTG 
0481 GTCCAGTTCC TGTTCAGTGT A 
 in silico PCR Fragment
0001 AGGAGCTGAT G-TTCCGCAA CTTCCAGCGC CTGAAAAGCT ACATCTTCGA CGACGAGAAG 
0061 GTGTCCACCA CCACATCCCG CGAGCAACAA AAGACGGAGA GTTCGGTGGA GAAATGCTTC 
0121 GACCGCTTCG AGCAGATAAT GTTCACCGAC CCGCGCCTCA CCCAGATCTT CCGGCTGGAG 
0181 CACCAGTACT ACCTGGACGC GATGCTGAGG CGGCTGCCGT CCAATTACGA GTGCCTGGAC 
0241 AGCAGTCGCG CGTGGTGCGT TTACTGGATC CTGCAGGCGG CCCAGCTACT TAGCTTTAAC 
0301 TTCGACGACC AGACATTGAA CCACGTGGTC CAGTTTCTAA GCAACTGCCG TTCGCCGACT 
0361 GGGGGTTTTG GAGGAGGACC TGGACAGTAT GCCCATCTGG CGCCCACCTA TGCAGCAGTG 
0421 AACAGTCTGT GCATCATCGG AAGCGAGCAG GCGTACCGTG CCATAGACCG ACCGACTTTG 
0481 GTCCAGTTCC TGTTCAGTGT A 
 Assemble Data

17565R-2.IR_full       1   AGGAGCTGATGTTTCCGCAACTTCCAGCGCCTGAAAAGCTACATCTTCGACGACGAGAAG 60
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     1   AGGAGCTGATG-TTCCGCAACTTCCAGCGCCTGAAAAGCTACATCTTCGACGACGAGAAG 60


17565R-2.IR_full       61  GTGTCCACCACCACATCCCGCGAGCAACAAAAGACGGAGAGTTCGGTGGAGAAATGCTTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     61  GTGTCCACCACCACATCCCGCGAGCAACAAAAGACGGAGAGTTCGGTGGAGAAATGCTTC 120


17565R-2.IR_full       121 GACCGCTTCGAGCAGATAATGTTCACCGACCCGCGCCTCACCCAGATCTTCCGGCTGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     121 GACCGCTTCGAGCAGATAATGTTCACCGACCCGCGCCTCACCCAGATCTTCCGGCTGGAG 180


17565R-2.IR_full       181 CACCAGTACTACCTGGACGCGATGCTGAGGCGGCTGCCGTCCAATTACGAGTGCCTGGAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     181 CACCAGTACTACCTGGACGCGATGCTGAGGCGGCTGCCGTCCAATTACGAGTGCCTGGAC 240


17565R-2.IR_full       241 AGCAGTCGCGCGTGGTGCGTTTACTGGATCCTGCAGGCGGCCCAGCTACTTAGCTTTAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     241 AGCAGTCGCGCGTGGTGCGTTTACTGGATCCTGCAGGCGGCCCAGCTACTTAGCTTTAAC 300


17565R-2.IR_full       301 TTCGACGACCAGACATTGAACCACGTGGTCCAGTTTCTAAGCAACTGCCGTTCGCCGACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     301 TTCGACGACCAGACATTGAACCACGTGGTCCAGTTTCTAAGCAACTGCCGTTCGCCGACT 360


17565R-2.IR_full       361 GGGGGTTTTGGAGGAGGACCTGGACAGTATGCCCATCTGGCGCCCACCTATGCAGCAGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     361 GGGGGTTTTGGAGGAGGACCTGGACAGTATGCCCATCTGGCGCCCACCTATGCAGCAGTG 420


17565R-2.IR_full       421 AACAGTCTGTGCATCATCGGAAGCGAGCAGGCGTACCGTGCCATAGACCGACCGACTTTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17565R-2.in silico     421 AACAGTCTGTGCATCATCGGAAGCGAGCAGGCGTACCGTGCCATAGACCGACCGACTTTG 480


17565R-2.IR_full       481 GTCCAGTTCCTGTTCAGTGTA 501
                           |||||||||||||||||||||
17565R-2.in silico     481 GTCCAGTTCCTGTTCAGTGTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142283.2  CG17565-RA (CG17565), mRNA 
0   NM_140530.1  CG13449-RA (CG13449), mRNA 
0   NM_142587.1  CG4755-RA (RhoGAP92B), mRNA 
0   NM_136515.2  CG8709-RA (CG8709), mRNA 
0   NM_166955.2  CG3588-RC, transcript variant C (CG3588), mRNA 
0   NM_001031868.1  CG3588-RD, transcript variant D (CG3588), mRNA 
0   NM_130680.2  CG3588-RB, transcript variant B (CG3588), mRNA 
0   NM_166956.3  CG3588-RA, transcript variant A (CG3588), mRNA 
0   NM_057719.3  CG8274-RA (Mtor), mRNA 
0   NM_168551.1  CG32130-RA, transcript variant A (stv), mRNA 
0   NM_168554.1  CG32130-RD, transcript variant D (stv), mRNA 
0   NM_168552.1  CG32130-RC, transcript variant C (stv), mRNA 
0   NM_168553.1  CG32130-RB, transcript variant B (stv), mRNA 
0   NM_078564.2  CG1594-RA (hop), mRNA 
0   NM_139952.1  CG7076-RA (CG7076), mRNA 
0   NM_139892.1  CG12262-RA (CG12262), mRNA 
0   NM_136171.2  CG16772-RA (CG16772), mRNA 
0   10  NM_206074.1  CG12908-RB, transcript variant B (Ndg), mRNA 
0   10  NM_136731.1  CG12908-RA, transcript variant A (Ndg), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_136332.2  CG8426-RA (l(2)NC136), mRNA 
0   NM_142739.2  CG6678-RA (CG6678), mRNA 
0   NM_137618.1  CG9864-RA (CG9864), mRNA 
0   NM_001014557.1  CG33545-RA (nab), mRNA 
0   NM_141809.1  CG6715-RA (KP78a), mRNA 
0   NM_165180.1  CG11397-RA (glu), mRNA 
0   NM_139436.1  CG15822-RC (CG15822), mRNA 
0   NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.