National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1751R-4 
 Symbol Spase25  Full Name Spase 25-subunit 
 CG No CG1751  Old CG No CG1751 
 Synonyms CG1751, Spase25 
 Accession No (Link to NCBI) NM_132495.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGCAAGAAGGATGAAAAGTC 
 Primer Seq. 3'
aatctagaggtaccCATTCTGATCGATGAAGGCGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGCAAGAAG GATGAAAAGT CACAGCAAGG CGANGGAGCT GGTGAAGGTC AACAAGTGGG 
0061 ATGGATCCGC AGTGAAGCAC GCCCTCGATG ATGCAGTGAA AACCTGCCTC CTTGGCGATC 
0121 GTCCCCAGCT GAAGGAGCAA TTCGGCCTGG TCAACACCCG TTTGGCCCTC TGCGCCCTCG 
0181 CCGTTTCCGT GGCTATAATG GCCCATGCTT GGGACTTCAC CCACCCCTTC CCGGAATCCC 
0241 GTCCAGTGCT CCTCTTCAGT GTTTTGGCCT ACTTTGCACT CCTCGGCATT CTGACCCTGC 
0301 ACTCCAGTTT CCGCGAGAAG GGCACCTTTG CGGTGGCCCT GCAGAAGGAC AAGGAGCGGG 
0361 AGCGCCTGTG GGAGGCCAGC TCCGATATGC GCAAGTACGA CGACAAGTAC CTGCTGACCC 
0421 TCAGTGTTCG CGACACGAAA AATGGCAAGC GGCGCGAGCA GAGCAAGCAA CAAGTCGTGC 
0481 GCCGCCTTCA TVGATCAGAA TG 
 in silico PCR Fragment
0001 GGGCAAGAAG GATGAAAAGT CACAGCAAGG CGA-GGAGCT GGTGAAGGTC AACAAGTGGG 
0061 ATGGATCCGC AGTGAAGCAC GCCCTCGATG ATGCAGTGAA AACCTGCCTC CTTGGCGATC 
0121 GTCCCCAGCT GAAGGAGCAA TTCGGCCTGG TCAACACCCG TTTGGCCCTC TGCGCCCTCG 
0181 CCGTTTCCGT GGCTATAATG GCCCATGCTT GGGACTTCAC CCACCCCTTC CCGGAATCCC 
0241 GTCCAGTGCT CCTCTTCAGT GTTTTGGCCT ACTTTGCACT CCTCGGCATT CTGACCCTGC 
0301 ACTCCAGTTT CCGCGAGAAG GGCACCTTTG CGGTGGCCCT GCAGAAGGAC AAGGAGCGGG 
0361 AGCGCCTGTG GGAGGCCAGC TCCGATATGC GCAAGTACGA CGACAAGTAC CTGCTGACCC 
0421 TCAGTGTTCG CGACACGAAA AATGGCAAGC GGCGCGAGCA GAGC-AGCAA CAAGTCGTGC 
0481 GCCGCCTTCA TCGATCAGAA TG 
 Assemble Data

1751R-4.IR_full       1   GGGCAAGAAGGATGAAAAGTCACAGCAAGGCGANGGAGCTGGTGAAGGTCAACAAGTGGG 60
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
1751R-4.in silico     1   GGGCAAGAAGGATGAAAAGTCACAGCAAGGCGA-GGAGCTGGTGAAGGTCAACAAGTGGG 60


1751R-4.IR_full       61  ATGGATCCGCAGTGAAGCACGCCCTCGATGATGCAGTGAAAACCTGCCTCCTTGGCGATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1751R-4.in silico     61  ATGGATCCGCAGTGAAGCACGCCCTCGATGATGCAGTGAAAACCTGCCTCCTTGGCGATC 120


1751R-4.IR_full       121 GTCCCCAGCTGAAGGAGCAATTCGGCCTGGTCAACACCCGTTTGGCCCTCTGCGCCCTCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1751R-4.in silico     121 GTCCCCAGCTGAAGGAGCAATTCGGCCTGGTCAACACCCGTTTGGCCCTCTGCGCCCTCG 180


1751R-4.IR_full       181 CCGTTTCCGTGGCTATAATGGCCCATGCTTGGGACTTCACCCACCCCTTCCCGGAATCCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1751R-4.in silico     181 CCGTTTCCGTGGCTATAATGGCCCATGCTTGGGACTTCACCCACCCCTTCCCGGAATCCC 240


1751R-4.IR_full       241 GTCCAGTGCTCCTCTTCAGTGTTTTGGCCTACTTTGCACTCCTCGGCATTCTGACCCTGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1751R-4.in silico     241 GTCCAGTGCTCCTCTTCAGTGTTTTGGCCTACTTTGCACTCCTCGGCATTCTGACCCTGC 300


1751R-4.IR_full       301 ACTCCAGTTTCCGCGAGAAGGGCACCTTTGCGGTGGCCCTGCAGAAGGACAAGGAGCGGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1751R-4.in silico     301 ACTCCAGTTTCCGCGAGAAGGGCACCTTTGCGGTGGCCCTGCAGAAGGACAAGGAGCGGG 360


1751R-4.IR_full       361 AGCGCCTGTGGGAGGCCAGCTCCGATATGCGCAAGTACGACGACAAGTACCTGCTGACCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1751R-4.in silico     361 AGCGCCTGTGGGAGGCCAGCTCCGATATGCGCAAGTACGACGACAAGTACCTGCTGACCC 420


1751R-4.IR_full       421 TCAGTGTTCGCGACACGAAAAATGGCAAGCGGCGCGAGCAGAGCAAGCAACAAGTCGTGC 480
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
1751R-4.in silico     421 TCAGTGTTCGCGACACGAAAAATGGCAAGCGGCGCGAGCAGAGC-AGCAACAAGTCGTGC 480


1751R-4.IR_full       481 GCCGCCTTCATVGATCAGAATG 502
                          ||||||||||| ||||||||||
1751R-4.in silico     481 GCCGCCTTCATCGATCAGAATG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132495.2  CG1751-RA (Spase25), mRNA 
0   NM_132837.1  CG8944-RB, transcript variant B (CG8944), mRNA 
0   NM_167460.1  CG8944-RA, transcript variant A (CG8944), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
0   NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
0   NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0   NM_132686.2  CG32627-RA, transcript variant A (CG32627), mRNA 
0   NM_167379.1  CG32627-RB, transcript variant B (CG32627), mRNA 
0   NM_176726.1  CG32627-RC, transcript variant C (CG32627), mRNA 
0   NM_138070.2  CG3492-RA (CG3492), mRNA 
0   NM_142791.2  CG5378-RA (Rpn7), mRNA 
0   NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   NM_143722.2  CG4913-RA (ear), mRNA 
0   NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
0   NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
0   NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0   NM_142271.2  CG6126-RA (CG6126), mRNA 
0   NM_140195.2  CG6190-RA (As), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 
0   NM_130556.2  CG14785-RA (CG14785), mRNA 
0   NM_140901.2  CG7762-RA (Rpn1), mRNA 
0   NM_136079.2  CG10639-RA (CG10639), mRNA 
0   NM_132266.1  CG12081-RA (CG12081), mRNA 
0   NM_079437.2  CG32211-RA (Taf6), mRNA 
0   NM_164554.2  CG2822-RB, transcript variant B (Shaw), mRNA 
0   NM_057373.2  CG2822-RA, transcript variant A (Shaw), mRNA 
0   NM_079396.2  CG9712-RA (TSG101), mRNA 
0   10  11  NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_078698.2  CG1676-RA (cactin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.