National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1751R-3 
 Symbol Spase25  Full Name Spase 25-subunit 
 CG No CG1751  Old CG No CG1751 
 Synonyms CG1751, Spase25 
 Accession No (Link to NCBI) NM_132495.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     1   GGGCAAGAAGGATGAAAAGTCACAGCAAGGCGA-GGAGCTGGTGAAGGTCAACAAGTGGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGGATCCGCAGTGAAGCACGCCCTCGATGATGCAGTGAAAACCTGCCTCCTTGGCGATC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTCCCCAGCTGAAGGAGCAATTCGGCCTGGTCAACACCCGTTTGGCCCTCTGCGCCCTCG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCGTTTCCGTGGCTATAATGGCCCATGCTTGGGACTTCACCCACCCCTTCCCGGAATCCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTCCAGTGCTCCTCTTCAGTGTTTTGGCCTACTTTGCACTCCTCGGCATTCTGACCCTGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACTCCAGTTTCCGCGAGAAGGGCACCTTTGCGGTGGCCCTGCAGAAGGACAAGGAGCGGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCGCCTGTGGGAGGCCAGCTCCGATATGCGCAAGTACGACGACAAGTACCTGCTGACCC 420

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     421 TCAGTGTTCGCGACACGAAAAATGGCAAGCGGCGCGAGCAGAGC-AGCAACAAGTCGTGC 480

1751R-3.IR_full       481 GCCGCCTTCATVGATCAGAATG 502
                          ||||||||||| |||||||||| silico     481 GCCGCCTTCATCGATCAGAATG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132495.2  CG1751-RA (Spase25), mRNA 
0   NM_132837.1  CG8944-RB, transcript variant B (CG8944), mRNA 
0   NM_167460.1  CG8944-RA, transcript variant A (CG8944), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
0   NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
0   NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0   NM_132686.2  CG32627-RA, transcript variant A (CG32627), mRNA 
0   NM_167379.1  CG32627-RB, transcript variant B (CG32627), mRNA 
0   NM_176726.1  CG32627-RC, transcript variant C (CG32627), mRNA 
0   NM_138070.2  CG3492-RA (CG3492), mRNA 
0   NM_142791.2  CG5378-RA (Rpn7), mRNA 
0   NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   NM_143722.2  CG4913-RA (ear), mRNA 
0   NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
0   NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
0   NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0   NM_142271.2  CG6126-RA (CG6126), mRNA 
0   NM_140195.2  CG6190-RA (As), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 
0   NM_130556.2  CG14785-RA (CG14785), mRNA 
0   NM_140901.2  CG7762-RA (Rpn1), mRNA 
0   NM_136079.2  CG10639-RA (CG10639), mRNA 
0   NM_132266.1  CG12081-RA (CG12081), mRNA 
0   NM_079437.2  CG32211-RA (Taf6), mRNA 
0   NM_164554.2  CG2822-RB, transcript variant B (Shaw), mRNA 
0   NM_057373.2  CG2822-RA, transcript variant A (Shaw), mRNA 
0   NM_079396.2  CG9712-RA (TSG101), mRNA 
0   10  11  NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_078698.2  CG1676-RA (cactin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.