National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17486R-1 
 Symbol CG17486  Full Name CG17486 
 CG No CG17486  Old CG No CG17486 
 Synonyms CG40291, CG17486 
 Accession No (Link to NCBI) NM_001042981.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Coulthard AB, Alm C, Cealiac I, Sinclair DA, Honda BM, Rossi F, Dimitri P, Hilliker AJ.
Essential loci in centromeric heterochromatin of Drosophila melanogaster. I: the right arm of chromosome 2.
Genetics (2010) 185(2) 479-95 [ PubMed ID = 20382826 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTGAAAAACCGCGGTCCTGA 
 Primer Seq. 3'
aatctagaggtaccGGGGCTGCCATGGATACAATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTGAAAAAC CGCGGTCCTG ATGTGCAAGA CGAGGTGGTT ATAGATTATT GTTTTGGAAA 
0061 AATTTTATTT GCTGGCTTCG TGTTATGGCA ACAAGGGGAA AGTGTACAAA AGCAACCTGT 
0121 GGTGGAGGAC GATTTTATAT TTCTTTTCAA TGGAGACATT TACAATACTT CAAAGCCTGA 
0181 ATATATGTCT GACACGACTT GGATAGCGGA AAGGCTAGCT GAATGCCGTT GTAAAGAACA 
0241 GAATATTTTG AAGATACTTA AGCGATTGGA GGGACCACAT TGTTTAATAA TTTATGACAA 
0301 ACGAGAACAA ATCCTTTACT TTAGTCGCGA CGCACTTGGA AGAAATTCAC TATTAATTGA 
0361 ACGCATTTGT AATGGCTTCC AATTATTGAG CACATCACAT TTTGAAGATA AAAAAATATC 
0421 ACTGGAATTG CCCCCATTGG GTCTTTTTCG AGTTAAACTA AATGATCTGA ATTCGTGCGT 
0481 ATTGTATCCA TGGCAGCCCC  
 in silico PCR Fragment
0001 TCTGAAAAAC CGCGGTCCTG ATGTGCAAGA CGAGGTGGTT ATAGATTATT GTTTTGGAAA 
0061 AATTTTATTT GCTGGCTTCG TGTTATGGCA ACAAGGGGAA AGTGTACAAA AGCAACCTGT 
0121 GGTGGAGGAC GATTTTATAT TTCTTTTCAA TGGAGACATT TACAATACTT CAAAGCCTGA 
0181 ATATATGTCT GACACGACTT GGATAGCGGA AAGGCTAGCT GAATGCCGTT GTAAAGAACA 
0241 GAATATTTTG AAGATACTTA AGCGATTGGA GGGACCACAT TGTTTAATAA TTTATGACAA 
0301 ACGAGAACAA ATCCTTTACT TTAGTCGCGA CGCACTTGGA AGAAATTCAC TATTAATTGA 
0361 ACGCATTTGT AATGGCTTCC AATTATTGAG CACATCACAT TTTGAAGATA AAAAAATATC 
0421 ACTGGAATTG CCCCCATTGG GTCTTTTTCG AGTTAAACTA AATGATCTGA ATTCGTGCGT 
0481 ATTGTATCCA TGGCAGCCCC  
 Assemble Data

17486R-1.IR_full       1   TCTGAAAAACCGCGGTCCTGATGTGCAAGACGAGGTGGTTATAGATTATTGTTTTGGAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     1   TCTGAAAAACCGCGGTCCTGATGTGCAAGACGAGGTGGTTATAGATTATTGTTTTGGAAA 60


17486R-1.IR_full       61  AATTTTATTTGCTGGCTTCGTGTTATGGCAACAAGGGGAAAGTGTACAAAAGCAACCTGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     61  AATTTTATTTGCTGGCTTCGTGTTATGGCAACAAGGGGAAAGTGTACAAAAGCAACCTGT 120


17486R-1.IR_full       121 GGTGGAGGACGATTTTATATTTCTTTTCAATGGAGACATTTACAATACTTCAAAGCCTGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     121 GGTGGAGGACGATTTTATATTTCTTTTCAATGGAGACATTTACAATACTTCAAAGCCTGA 180


17486R-1.IR_full       181 ATATATGTCTGACACGACTTGGATAGCGGAAAGGCTAGCTGAATGCCGTTGTAAAGAACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     181 ATATATGTCTGACACGACTTGGATAGCGGAAAGGCTAGCTGAATGCCGTTGTAAAGAACA 240


17486R-1.IR_full       241 GAATATTTTGAAGATACTTAAGCGATTGGAGGGACCACATTGTTTAATAATTTATGACAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     241 GAATATTTTGAAGATACTTAAGCGATTGGAGGGACCACATTGTTTAATAATTTATGACAA 300


17486R-1.IR_full       301 ACGAGAACAAATCCTTTACTTTAGTCGCGACGCACTTGGAAGAAATTCACTATTAATTGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     301 ACGAGAACAAATCCTTTACTTTAGTCGCGACGCACTTGGAAGAAATTCACTATTAATTGA 360


17486R-1.IR_full       361 ACGCATTTGTAATGGCTTCCAATTATTGAGCACATCACATTTTGAAGATAAAAAAATATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     361 ACGCATTTGTAATGGCTTCCAATTATTGAGCACATCACATTTTGAAGATAAAAAAATATC 420


17486R-1.IR_full       421 ACTGGAATTGCCCCCATTGGGTCTTTTTCGAGTTAAACTAAATGATCTGAATTCGTGCGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17486R-1.in silico     421 ACTGGAATTGCCCCCATTGGGTCTTTTTCGAGTTAAACTAAATGATCTGAATTCGTGCGT 480


17486R-1.IR_full       481 ATTGTATCCATGGCAGCCCC 500
                           ||||||||||||||||||||
17486R-1.in silico     481 ATTGTATCCATGGCAGCCCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001042981.1  CG17486-RA (CG17486), mRNA 
0   NM_134973.2  CG2955-RA (CG2955), mRNA 
0   NM_165574.1  CG30379-RA (CG30379), mRNA 
0   NR_001643.1  CG30379-RA (CG30379), mRNA, miscRNA 
0   NM_140966.1  CG5262-RA (CG5262), mRNA 
0   NR_001644.1  CG5262-RA (CG5262), mRNA, miscRNA 
0   NM_133003.2  CG32555-RB, transcript variant B (RhoGAPp190), mRNA 
0   NM_167573.1  CG32555-RC, transcript variant C (RhoGAPp190), mRNA 
0   NM_167572.1  CG32555-RA, transcript variant A (RhoGAPp190), mRNA 
0   NM_136464.1  CG2070-RA (CG2070), mRNA 
0   NM_166982.1  CG2872-RC, transcript variant C (AlstR), mRNA 
0   NM_079961.2  CG2872-RB, transcript variant B (AlstR), mRNA 
0   NM_165890.2  CG13160-RA (CG13160), mRNA 
0   NM_078965.2  CG13225-RA (Or47a), mRNA 
0   NM_001042861.1  CG31973-RC, transcript variant C (CG31973), mRNA 
0   NM_164353.1  CG31973-RA, transcript variant A (CG31973), mRNA 
0   NM_164354.1  CG31973-RB, transcript variant B (CG31973), mRNA 
0   NM_135716.2  CG17010-RA, transcript variant A (CG17010), mRNA 
0   NM_165008.1  CG17010-RB, transcript variant B (CG17010), mRNA 
0   NM_168306.1  CG5651-RB, transcript variant B (CG5651), mRNA 
0   NM_140015.2  CG5651-RA, transcript variant A (CG5651), mRNA 
0   NM_001031858.1  CG33653-RC, transcript variant C (Caps), mRNA 
0   NM_001031860.1  CG33653-RA, transcript variant A (Caps), mRNA 
0   NM_001031859.1  CG33653-RB, transcript variant B (Caps), mRNA 
0   NM_135309.1  CG7134-RA (CG7134), mRNA 
0   NM_140645.1  CG13033-RA (CG13033), mRNA 
0   NM_165133.2  CG31822-RA (CG31822), mRNA 
0   NM_143432.2  CG31445-RA (CG31445), mRNA 
0   NM_169082.1  CG31551-RA (CG31551), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.