National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17361R-2 
 Symbol CG17361  Full Name CG17361 
 CG No CG17361  Old CG No CG17361 
 Synonyms CG17361 
 Accession No (Link to NCBI) NM_140421.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTGAAGATGTGCCGGGTGTG 
 Primer Seq. 3'
aatctagaggtaccGCCTGTGCATGGTCAACTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNTGAAGATG TGCCGGGTGT GTATGGACGA GCCGNAgGAC CTGCTAGACA TCTACGACAA 
0061 CAAGAGCTTG GGGGACAGAC TGAGCGACGA TCTACAGCGA ACCAAGGAAC CGGAGCCCAC 
0121 GCCGGCTGAT TTGCTGAATA TCTGCAGCGC CATATCCAGT GGATACCGGG GACgGCTTTC 
0181 CGCTGAAAAT TTGCGAACCG TGCCTATTTA TTAAATTGCG TGAGGCCTTG AGATTCAGGA 
0241 NNCGCTANAC AAGGNCCATN GAATACGTGG CGCGCGTGAA GAGGGAGNAA AGCGACAAGG 
0301 AGACATGCGA TCTCCTGGAG GCCGAGGATT GGGATTTTAN GGATCGCATC AAGAGCGAgg 
0361 agGAGGAGGA GGAGGACGAT GGGGACCGGA ACGATAAGCA GCCGAAGAAG GAGACTCGCA 
0421 ACGAGGTGGA TAAGAGGCGG CCCTTCAAAT GCACCGACTG CCAAAAAAGT TTCACCgGCA 
0481 AGGCCCAGTT GACCATGCAC ANGN 
 in silico PCR Fragment
0001 GGTGAAGATG TGCCGGGTGT GTATGGACGA GCCGAAGGAC CTGCTAGACA TCTACGACAA 
0061 CAAGAGCTTG GGGGACAGAC TGAGCGACGA TCTACAGCGA ACCAAGGAAC CGGAGCCCAC 
0121 GCCGGCTGAT TTGCTGAATA TCTGCAGCG- CATATCCAGT GGATACCGGG GACGGCTTTC 
0181 CGCTGAAAAT TTGCGAACCG TGCC---TTA TTAAATTGCG TGAGGCCTTG AGATTCAGGA 
0241 GACGCTACAC AAGGACCATG GAATACGTGG CGCGCGTGAA GAGGGAGCAA AGCGACAAGG 
0301 AGACATGCGA TCTCCTGGAG GCCGAGGATT GGGATTTTAC GGATCGCATC AAGAGCGAGG 
0361 AGGAGGAGGA GGAGGACGAT GGGGACCGGA ACGATAAGCA GCCGAAGAAG GAGACTCGCA 
0421 ACGAGGTGGA TAAGAGGCGG CCCTTCAAAT GCACCGACTG CCAAAAAAGT TTCACCGGCA 
0481 AGGCCCAGTT GACCATGCAC AGGC 
 Assemble Data

17361R-2.IR_full       1   GNTGAAGATGTGCCGGGTGTGTATGGACGAGCCGNAGGACCTGCTAGACATCTACGACAA 60
                           | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
17361R-2.in silico     1   GGTGAAGATGTGCCGGGTGTGTATGGACGAGCCGAAGGACCTGCTAGACATCTACGACAA 60


17361R-2.IR_full       61  CAAGAGCTTGGGGGACAGACTGAGCGACGATCTACAGCGAACCAAGGAACCGGAGCCCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17361R-2.in silico     61  CAAGAGCTTGGGGGACAGACTGAGCGACGATCTACAGCGAACCAAGGAACCGGAGCCCAC 120


17361R-2.IR_full       121 GCCGGCTGATTTGCTGAATATCTGCAGCGCCATATCCAGTGGATACCGGGGACGGCTTTC 180
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
17361R-2.in silico     121 GCCGGCTGATTTGCTGAATATCTGCAGCG-CATATCCAGTGGATACCGGGGACGGCTTTC 180


17361R-2.IR_full       181 CGCTGAAAATTTGCGAACCGTGCCTATTTATTAAATTGCGTGAGGCCTTGAGATTCAGGA 240
                           ||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||
17361R-2.in silico     181 CGCTGAAAATTTGCGAACCGTGCC---TTATTAAATTGCGTGAGGCCTTGAGATTCAGGA 240


17361R-2.IR_full        N241 CGCTANACAAGGNCCATNGAATACGTGGCGCGCGTGAAGAGGGAGNAAAGCGACAAGG 298
                             ||||| |||||| |||| ||||||||||||||||||||||||||| ||||||||||||
17361R-2.in silico      G241 CGCTACACAAGGACCATGGAATACGTGGCGCGCGTGAAGAGGGAGCAAAGCGACAAGG 298


17361R-2.IR_full       301 AGACATGCGATCTCCTGGAGGCCGAGGATTGGGATTTTANGGATCGCATCAAGAGCGAGG 358
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
17361R-2.in silico     301 AGACATGCGATCTCCTGGAGGCCGAGGATTGGGATTTTACGGATCGCATCAAGAGCGAGG 358


17361R-2.IR_full       361 AGGAGGAGGAGGAGGACGATGGGGACCGGAACGATAAGCAGCCGAAGAAGGAGACTCGCA 418
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17361R-2.in silico     361 AGGAGGAGGAGGAGGACGATGGGGACCGGAACGATAAGCAGCCGAAGAAGGAGACTCGCA 418


17361R-2.IR_full       421 ACGAGGTGGATAAGAGGCGGCCCTTCAAATGCACCGACTGCCAAAAAAGTTTCACCGGCA 478
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17361R-2.in silico     421 ACGAGGTGGATAAGAGGCGGCCCTTCAAATGCACCGACTGCCAAAAAAGTTTCACCGGCA 478


17361R-2.IR_full       481 AGGCCCAGTTGACCATGCACANGN 502
                           ||||||||||||||||||||| | 
17361R-2.in silico     481 AGGCCCAGTTGACCATGCACAGGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  18  NM_140421.2  CG17361-RA (CG17361), mRNA 
3.11   15  38  44  75  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
3.11   15  38  44  75  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
2.07   10  21  19  42  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
1.86   19  25  51  NM_135975.2  CG31781-RB (CG31781), mRNA 
1.86   13  20  38  NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
1.86   13  20  38  NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
1.86   13  18  36  NM_143222.1  CG14237-RA (CG14237), mRNA 
1.45   23  30  59  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
1.45   22  24  41  NM_140288.2  CG6801-RA (l(3)j2D3), mRNA 
1.45   20  46  79  NM_133114.2  CG32541-RA (CG32541), mRNA 
1.45   17  21  49  NM_167309.1  CG32663-RA (CG32663), mRNA 
1.24   17  15  33  NM_176374.1  CG4761-RA (knrl), mRNA 
1.24   15  18  27  NM_138057.1  CG13576-RA (CG13576), mRNA 
1.24   13  26  39  NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
1.24   13  25  36  NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
1.24   13  25  36  NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
1.24   13  25  34  NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
1.24   13  23  31  NM_143338.2  CG12259-RA (CG12259), mRNA 
1.24   14  20  NM_140782.4  CG13702-RB, transcript variant B (AlCR2), mRNA 
1.24   14  20  NM_001031964.1  CG13702-RC, transcript variant C (AlCR2), mRNA 
1.03   22  44  72  NM_167340.1  CG32648-RA (Pde9), mRNA 
1.03   16  42  75  NM_133104.2  CG7282-RA (CG7282), mRNA 
1.03   16  24  47  NM_057406.3  CG6222-RA (su(s)), mRNA 
1.03   16  23  37  NM_135079.4  CG14021-RB, transcript variant B (CG14021), mRNA 
1.03   16  23  37  NM_164640.1  CG14021-RA, transcript variant A (CG14021), mRNA 
1.03   15  18  33  NM_135495.2  CG4778-RA (CG4778), mRNA 
1.03   10  11  24  NM_143000.1  CG17782-RA (CG17782), mRNA 
0.82   21  34  49  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0.82   20  25  37  NM_206764.1  CG4429-RC, transcript variant C (Rbp2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.