National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17359R-2 
 Symbol CG17359  Full Name CG17359 
 CG No CG17359  Old CG No CG17359 
 Synonyms CG17359 
 Accession No (Link to NCBI) NM_140422.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTGCAGGGACGAATCCGACT 
 Primer Seq. 3'
aatctagaggtaccCCTCCTCTTGGACTTATTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTGCAGGGA CGAATCCGAC TGCCTGTTGG ATATATATAC AGAGCCATAT GCCTCCTCCA 
0061 ATCGGGTCCA GGAGCAGGAG CCGGTCTTGN CCACAATGCT GAGGGAATGC AGCGGANGcA 
0121 GCGTGCATAA GGAGGACGGA ATGCCNCAGT TCATCTGCGT GGAGTGTGCG GAGGCCGTAA 
0181 GAAATGCCTA TCGGCTAAGA CGGCAATGCC GAAAGAGCCA TCAGTACTTT GAACAGCTGC 
0241 GTCTGATGAT GAAGGAGCTG GACGATATAG AGTATTGCCT GAATATAGGG GATAACATAG 
0301 AACCACAGAT GCCGGTCTCG GTAATGGAAG CTGGTAAAAC GCCGGAGACA TCCGAACCTC 
0361 TTTTAGTTGA GCTTGTGCAG GTTAAGTACA TGCCTCCAGA GCCGAAACCA ATATCTTCTC 
0421 CTCTTCCAGA CAACAATGAG CATAANCTCG CGCNAAAGTT ATTCTCCAGC AAAGACGCCA 
0481 CACAATAAGT CCAAGAGGAG G 
 in silico PCR Fragment
0001 TTTGCAGGGA CGAATCCGAC TGCCTGTTGG ATATATATAC AGAGCCATAT GCCTCCTCCA 
0061 ATCGGGTCCA GGAGCAGGAG CCGGTCTTGG CCACAATGCT GAGGGAATGC AGCGGATGCA 
0121 GCGTGCATAA GGAGGACGGA ATGCCGCAGT TCATCTGCGT GGAGTGTGCG GAGGCCGTAA 
0181 GAAATGCCTA TCGGCTAAGA CGGCAATGCC GAAAGAGCCA TCAGTACTTT GAACAGCTGC 
0241 GTCTGATGAT GAAGGAGCTG GACGATATAG AGTATTGCCT GAATATAGGG GATAACATAG 
0301 AACCACAGAT GCCGGTCTCG GTAATGGAAG CTGGTAAAAC GCCGGAGACA TCCGAACCTC 
0361 TTTTAGTTGA GCTTGTGCAG GTTAAGTACA TGCCTCCAGA GCCGAAGCCA ATATCTTCTC 
0421 CTCTTCCAGA CAACAATGAG CATAAGCTCG CGC-AAAGTT ATTCTCCAGC AAAGACGCCA 
0481 CACAATAAGT CCAAGAGGAG G 
 Assemble Data

17359R-2.IR_full       1   TTTGCAGGGACGAATCCGACTGCCTGTTGGATATATATACAGAGCCATATGCCTCCTCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17359R-2.in silico     1   TTTGCAGGGACGAATCCGACTGCCTGTTGGATATATATACAGAGCCATATGCCTCCTCCA 60


17359R-2.IR_full       61  ATCGGGTCCAGGAGCAGGAGCCGGTCTTGNCCACAATGCTGAGGGAATGCAGCGGANGCA 120
                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
17359R-2.in silico     61  ATCGGGTCCAGGAGCAGGAGCCGGTCTTGGCCACAATGCTGAGGGAATGCAGCGGATGCA 120


17359R-2.IR_full       121 GCGTGCATAAGGAGGACGGAATGCCNCAGTTCATCTGCGTGGAGTGTGCGGAGGCCGTAA 180
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
17359R-2.in silico     121 GCGTGCATAAGGAGGACGGAATGCCGCAGTTCATCTGCGTGGAGTGTGCGGAGGCCGTAA 180


17359R-2.IR_full       181 GAAATGCCTATCGGCTAAGACGGCAATGCCGAAAGAGCCATCAGTACTTTGAACAGCTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17359R-2.in silico     181 GAAATGCCTATCGGCTAAGACGGCAATGCCGAAAGAGCCATCAGTACTTTGAACAGCTGC 240


17359R-2.IR_full       241 GTCTGATGATGAAGGAGCTGGACGATATAGAGTATTGCCTGAATATAGGGGATAACATAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17359R-2.in silico     241 GTCTGATGATGAAGGAGCTGGACGATATAGAGTATTGCCTGAATATAGGGGATAACATAG 300


17359R-2.IR_full       301 AACCACAGATGCCGGTCTCGGTAATGGAAGCTGGTAAAACGCCGGAGACATCCGAACCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17359R-2.in silico     301 AACCACAGATGCCGGTCTCGGTAATGGAAGCTGGTAAAACGCCGGAGACATCCGAACCTC 360


17359R-2.IR_full       361 TTTTAGTTGAGCTTGTGCAGGTTAAGTACATGCCTCCAGAGCCGAAACCAATATCTTCTC 420
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
17359R-2.in silico     361 TTTTAGTTGAGCTTGTGCAGGTTAAGTACATGCCTCCAGAGCCGAAGCCAATATCTTCTC 420


17359R-2.IR_full       421 CTCTTCCAGACAACAATGAGCATAANCTCGCGCNAAAGTTATTCTCCAGCAAAGACGCCA 480
                           ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||
17359R-2.in silico     421 CTCTTCCAGACAACAATGAGCATAAGCTCGCGC-AAAGTTATTCTCCAGCAAAGACGCCA 480


17359R-2.IR_full       481 CACAATAAGTCCAAGAGGAGG 501
                           |||||||||||||||||||||
17359R-2.in silico     481 CACAATAAGTCCAAGAGGAGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140422.2  CG17359-RA (CG17359), mRNA 
0   NM_140602.1  CG13050-RA (CG13050), mRNA 
0   NM_138041.2  CG4049-RA (CG4049), mRNA 
0   NM_139827.1  CG17742-RA (CG17742), mRNA 
0   NM_164990.2  CG6716-RB, transcript variant B (prd), mRNA 
0   NM_078832.2  CG6716-RA, transcript variant A (prd), mRNA 
0   NM_079372.2  CG6215-RA (CkIIalpha-i1), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_165902.1  CG30051-RB (CG30051), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_141493.2  CG2678-RA (CG2678), mRNA 
0   NM_144124.1  CG8085-RA, transcript variant A (RN-tre), mRNA 
0   NM_166028.1  CG8085-RC, transcript variant C (RN-tre), mRNA 
0   NM_079012.2  CG8085-RB, transcript variant B (RN-tre), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   NM_136220.1  CG9333-RA (Oseg5), mRNA 
0   NM_057798.2  CG1650-RA (unpg), mRNA 
0   NM_136936.3  CG8520-RA (CG8520), mRNA 
0   NM_170493.1  CG31020-RA (spdo), mRNA 
0   NM_167485.1  CG9216-RC, transcript variant C (CG9216), mRNA 
0   NM_132878.1  CG9216-RA, transcript variant A (CG9216), mRNA 
0   15  NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.