National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17359R-1 
 Symbol CG17359  Full Name CG17359 
 CG No CG17359  Old CG No CG17359 
 Synonyms CG17359 
 Accession No (Link to NCBI) NM_140422.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTGCAGGGACGAATCCGACTGCCTGTTGGATATATATACAGAGCCATATGCCTCCTCCA 60

                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| silico     61  ATCGGGTCCAGGAGCAGGAGCCGGTCTTGGCCACAATGCTGAGGGAATGCAGCGGATGCA 120

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     121 GCGTGCATAAGGAGGACGGAATGCCGCAGTTCATCTGCGTGGAGTGTGCGGAGGCCGTAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAAATGCCTATCGGCTAAGACGGCAATGCCGAAAGAGCCATCAGTACTTTGAACAGCTGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTCTGATGATGAAGGAGCTGGACGATATAGAGTATTGCCTGAATATAGGGGATAACATAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACCACAGATGCCGGTCTCGGTAATGGAAGCTGGTAAAACGCCGGAGACATCCGAACCTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     361 TTTTAGTTGAGCTTGTGCAGGTTAAGTACATGCCTCCAGAGCCGAAGCCAATATCTTCTC 420

                           ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| silico     421 CTCTTCCAGACAACAATGAGCATAAGCTCGCGC-AAAGTTATTCTCCAGCAAAGACGCCA 480

17359R-1.IR_full       481 CACAATAAGTCCAAGAGGAGG 501
                           ||||||||||||||||||||| silico     481 CACAATAAGTCCAAGAGGAGG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140422.2  CG17359-RA (CG17359), mRNA 
0   NM_140602.1  CG13050-RA (CG13050), mRNA 
0   NM_138041.2  CG4049-RA (CG4049), mRNA 
0   NM_139827.1  CG17742-RA (CG17742), mRNA 
0   NM_164990.2  CG6716-RB, transcript variant B (prd), mRNA 
0   NM_078832.2  CG6716-RA, transcript variant A (prd), mRNA 
0   NM_079372.2  CG6215-RA (CkIIalpha-i1), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_165902.1  CG30051-RB (CG30051), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_141493.2  CG2678-RA (CG2678), mRNA 
0   NM_144124.1  CG8085-RA, transcript variant A (RN-tre), mRNA 
0   NM_166028.1  CG8085-RC, transcript variant C (RN-tre), mRNA 
0   NM_079012.2  CG8085-RB, transcript variant B (RN-tre), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   NM_136220.1  CG9333-RA (Oseg5), mRNA 
0   NM_057798.2  CG1650-RA (unpg), mRNA 
0   NM_136936.3  CG8520-RA (CG8520), mRNA 
0   NM_170493.1  CG31020-RA (spdo), mRNA 
0   NM_167485.1  CG9216-RC, transcript variant C (CG9216), mRNA 
0   NM_132878.1  CG9216-RA, transcript variant A (CG9216), mRNA 
0   15  NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.