National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17347R-2 
 Symbol l(2)37Ce  Full Name lethal (2) 37Ce 
 CG No CG17347  Old CG No CG17347 
 Synonyms l(2)37Ce, CG17347, Ce, l(2)E62, l(2)37Ce)E62 
 Accession No (Link to NCBI) NM_136105.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCGCGGTGACATCACCTTC 
 Primer Seq. 3'
aatctagaggtaccTGCGCGCCTTCTTGGGATCGT 
 Predicted Fragment Size
487 
 IR fragment full Seq
0001 CTGCGNNGTG ACATCACCTT NCTCGTCGGG CTGTGTGGTT CATCCGAGTG CCACCGTTAT 
0061 CGCCGACGCA GGGCCCATAA TAATTGGGGA GAATTGCATC ATAGAGGAAT ATGCCACCGT 
0121 AGCTCACCGC TTGGAGCCGG GCGCCGTTTG GGATGTCAAC AATATCCTGA GCATTGGCAC 
0181 TCACAATGTC TTTGAAGTCG GCTGCCAAGT GGAAGCGGCC AAGATTGGCG ATAAGAACGT 
0241 CTTCGAGAGC AAGTGCTATG TGGGCCCCGG TGTCACTGTT TCCAGCGGTT GTGTGGTGGG 
0301 AGCTGGAATA AAGATCCATG GTAGTCAACG CCTGCCCGAA AACACGATTG TTTATGGAGA 
0361 GCAGGGCCTG CAGCGCGAGG CCATCGACAA GCAGGGATCG CAGACCCTGC AGATCGACTT 
0421 CCTGCGCAAG GTCCTGCCAA ACTATCATCA TCTACGCAAG CCCAACTACG ATCCCAAGAA 
0481 NGGCGCGCA 
 in silico PCR Fragment
0001 CTGCGCGGTG ACATCACCTT -CTCGTCGGG CTGTGTGGTT CATCCGAGTG CCACCGTTAT 
0061 CGCCGACGCA GGTCCCATAA TAATTGGGGA GAATTGCATC ATAGAGGAAT ATGCCACCGT 
0121 AGCTCACCGC TTGGAGCCGG GCGCCGTTTG GGATGTCAAC AATATCCTGA GCATTGGCAC 
0181 TCACAATGTC TTTGAAGTCG GCTGCCAAGT GGAAGCGGCC AAGATTGGCG ATAAGAACGT 
0241 CTTCGAGAGC AAGTGCTATG TGGGCCCCGG TGTCACTGTT TCCAGCGGTT GTGTGGTGGG 
0301 AGCTGGAATA AAGATCCATG GTAGTCAACG CCTGCCCGAA AACACGATTG TTTATGGAGA 
0361 GCAGGGCCTG CAGCGCGAGG CCATCGACAA GCAGGGATCG CAGACCCTGC AGATCGACTT 
0421 CCTGCGCAAG GTCCTGCCAA ACTATCATCA TCTACGCAAG CCCAACTACG ATCCCAAGAA 
0481 -GGCGCGCA 
 Assemble Data

17347R-2.IR_full       1   CTGCGNNGTGACATCACCTTNCTCGTCGGGCTGTGTGGTTCATCCGAGTGCCACCGTTAT 60
                           |||||  ||||||||||||| |||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     1   CTGCGCGGTGACATCACCTT-CTCGTCGGGCTGTGTGGTTCATCCGAGTGCCACCGTTAT 60


17347R-2.IR_full       61  CGCCGACGCAGGGCCCATAATAATTGGGGAGAATTGCATCATAGAGGAATATGCCACCGT 120
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     61  CGCCGACGCAGGTCCCATAATAATTGGGGAGAATTGCATCATAGAGGAATATGCCACCGT 120


17347R-2.IR_full       121 AGCTCACCGCTTGGAGCCGGGCGCCGTTTGGGATGTCAACAATATCCTGAGCATTGGCAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     121 AGCTCACCGCTTGGAGCCGGGCGCCGTTTGGGATGTCAACAATATCCTGAGCATTGGCAC 180


17347R-2.IR_full       181 TCACAATGTCTTTGAAGTCGGCTGCCAAGTGGAAGCGGCCAAGATTGGCGATAAGAACGT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     181 TCACAATGTCTTTGAAGTCGGCTGCCAAGTGGAAGCGGCCAAGATTGGCGATAAGAACGT 240


17347R-2.IR_full       241 CTTCGAGAGCAAGTGCTATGTGGGCCCCGGTGTCACTGTTTCCAGCGGTTGTGTGGTGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     241 CTTCGAGAGCAAGTGCTATGTGGGCCCCGGTGTCACTGTTTCCAGCGGTTGTGTGGTGGG 300


17347R-2.IR_full       301 AGCTGGAATAAAGATCCATGGTAGTCAACGCCTGCCCGAAAACACGATTGTTTATGGAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     301 AGCTGGAATAAAGATCCATGGTAGTCAACGCCTGCCCGAAAACACGATTGTTTATGGAGA 360


17347R-2.IR_full       361 GCAGGGCCTGCAGCGCGAGGCCATCGACAAGCAGGGATCGCAGACCCTGCAGATCGACTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     361 GCAGGGCCTGCAGCGCGAGGCCATCGACAAGCAGGGATCGCAGACCCTGCAGATCGACTT 420


17347R-2.IR_full       421 CCTGCGCAAGGTCCTGCCAAACTATCATCATCTACGCAAGCCCAACTACGATCCCAAGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17347R-2.in silico     421 CCTGCGCAAGGTCCTGCCAAACTATCATCATCTACGCAAGCCCAACTACGATCCCAAGAA 480


17347R-2.IR_full        481 GGCGCGCA 488
                            ||||||||
17347R-2.in silico      481 GGCGCGCA 488

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   469  NM_136105.1  CG17347-RA (CG17347), mRNA 
0.21   NM_001014686.1  CG2381-RG, transcript variant G (Syt7), mRNA 
0.21   NM_166749.1  CG2381-RB, transcript variant B (Syt7), mRNA 
0.21   NM_166748.3  CG2381-RA, transcript variant A (Syt7), mRNA 
0.21   NM_166751.3  CG2381-RE, transcript variant E (Syt7), mRNA 
0.21   NM_143659.3  CG2381-RC, transcript variant C (Syt7), mRNA 
0.21   NM_205871.2  CG2381-RF, transcript variant F (Syt7), mRNA 
0   NM_165129.1  CG3903-RE, transcript variant E (Gli), mRNA 
0   NM_165127.1  CG3903-RC, transcript variant C (Gli), mRNA 
0   NM_165128.1  CG3903-RD, transcript variant D (Gli), mRNA 
0   NM_057254.3  CG3903-RA, transcript variant A (Gli), mRNA 
0   NM_166705.1  CG2679-RB, transcript variant B (gol), mRNA 
0   NM_079116.2  CG12240-RA, transcript variant A (DnaJ-60), mRNA 
0   NM_138048.1  CG12240-RB, transcript variant B (DnaJ-60), mRNA 
0   NM_057257.3  CG7664-RA (crp), mRNA 
0   NM_142995.2  CG5762-RA (CG5762), mRNA 
0   NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   NM_164392.1  CG3365-RC, transcript variant C (drongo), mRNA 
0   NM_164391.1  CG3365-RA, transcript variant A (drongo), mRNA 
0   10  NM_137046.3  CG6191-RA (CG6191), mRNA 
0   NM_165203.1  CG31784-RA, transcript variant A (CG31784), mRNA 
0   NM_165204.1  CG31784-RB, transcript variant B (CG31784), mRNA 
0   NM_132895.2  CG9984-RA (TH1), mRNA 
0   NM_130462.2  CG6562-RB, transcript variant B (synj), mRNA 
0   NM_166505.1  CG6562-RA, transcript variant A (synj), mRNA 
0   NM_140257.1  CG7283-RA, transcript variant A (RpL10Ab), mRNA 
0   NM_168480.1  CG7283-RB, transcript variant B (RpL10Ab), mRNA 
0   NM_139716.2  CG10596-RB, transcript variant B (Msr-110), mRNA 
0   NM_168123.1  CG10596-RA, transcript variant A (Msr-110), mRNA 
0   NM_168124.1  CG10596-RC, transcript variant C (Msr-110), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.