National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17324R-1 
 Symbol CG17324  Full Name CG17324 
 CG No CG17324  Old CG No CG17324 
 Synonyms GH06505, BEST:GH06505, CG17324 
 Accession No (Link to NCBI) NM_136065.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGAGAAACCAGTGGCCAAC 
 Primer Seq. 3'
aatctagaggtaccTCAGCGATCAGGGCATCGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGGAGAAAC CAGTGGCCAA CTACACGGAT TACGTCTTTC AAGGAATGCC TTTGCTCACC 
0061 GATATTGTGG ACTTAAGTAA CTTTGAATCC GAATGGAAGC CCCTGGGACT GCCGTTCAAG 
0121 GTGCCCACCT ACTTTATGCT TCACGATTGG GGTCTGCGAT CCTGTAAGGT GGCCCTGAAC 
0181 TCACCCCTCA TCACCCAACT GCTCAAGTCC CCCATTCGAT ATGACGTCAT ACTCCTGGAA 
0241 CACTTCTCCA ACGATTGCAT GGCANGCGGT GGCCCACCTA TTGAATGCAC CTGTAATCGC 
0301 ATTGAGTAGC TGTGCGANTA ATGCCGTGGC ACTATAAACG CATGGGAAGT CCGTTCATTA 
0361 ACCCCATTAT GCCCATGAAT TTCCTGCCCT ACACTGATGA GATGAGTCTG ATCGATCGAC 
0421 TGAATAATTT CTTTCATTTC CACACCGTTA ATACTCTGTA CAACATGATT ACCCAACCAG 
0481 CCACCGATGC CCTGATCGCT GA 
 in silico PCR Fragment
0001 CTGGAGAAAC CAGTGGCCAA CTACACGGAT TACGTCTTTC AAGGAATGCC CTTGCTCACC 
0061 GATATTGTGG ACTTAAGTAA CTTTGAATCC GAATGGAAGC CCCTGGGACT GCCGTTCAAG 
0121 GTGCCCACCT ACTTTATGCT TCACGATTGG GGTCTGCGAT CCTGTAAGGT GGCCCTGAAC 
0181 TCACCCCTCA TCACCCAACT GCTCAAGTCC CCCATTCGAT ATGACGTCAT ACTCCTGGAA 
0241 CACTTCTCCA ACGATTGCAT GGCA-GCGGT GGCCCACCTA TTGAATGCAC CTGTAATCGC 
0301 ATTGAGTAGC TGTGCGA-TA ATGCCGTGGC ACTACAAACG CATGGGAAGT CCGTTCATTA 
0361 ACCCCATTAT GCCCATGAAT TTCCTGCCCT ACACTGATGA GATGAGTCTG ATCGATCGAC 
0421 TGAATAATTT CTTTCATTTC CACACCGTTA ATACTCTGTA CAACATGATT ACCCAACCAG 
0481 CCACCGATGC CCTGATCGCT GA 
 Assemble Data

17324R-1.IR_full       1   CTGGAGAAACCAGTGGCCAACTACACGGATTACGTCTTTCAAGGAATGCCTTTGCTCACC 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
17324R-1.in silico     1   CTGGAGAAACCAGTGGCCAACTACACGGATTACGTCTTTCAAGGAATGCCCTTGCTCACC 60


17324R-1.IR_full       61  GATATTGTGGACTTAAGTAACTTTGAATCCGAATGGAAGCCCCTGGGACTGCCGTTCAAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17324R-1.in silico     61  GATATTGTGGACTTAAGTAACTTTGAATCCGAATGGAAGCCCCTGGGACTGCCGTTCAAG 120


17324R-1.IR_full       121 GTGCCCACCTACTTTATGCTTCACGATTGGGGTCTGCGATCCTGTAAGGTGGCCCTGAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17324R-1.in silico     121 GTGCCCACCTACTTTATGCTTCACGATTGGGGTCTGCGATCCTGTAAGGTGGCCCTGAAC 180


17324R-1.IR_full       181 TCACCCCTCATCACCCAACTGCTCAAGTCCCCCATTCGATATGACGTCATACTCCTGGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17324R-1.in silico     181 TCACCCCTCATCACCCAACTGCTCAAGTCCCCCATTCGATATGACGTCATACTCCTGGAA 240


17324R-1.IR_full       241 CACTTCTCCAACGATTGCATGGCANGCGGTGGCCCACCTATTGAATGCACCTGTAATCGC 300
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
17324R-1.in silico     241 CACTTCTCCAACGATTGCATGGCA-GCGGTGGCCCACCTATTGAATGCACCTGTAATCGC 300


17324R-1.IR_full       301 ATTGAGTAGCTGTGCGANTAATGCCGTGGCACTATAAACGCATGGGAAGTCCGTTCATTA 360
                           ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||
17324R-1.in silico     301 ATTGAGTAGCTGTGCGA-TAATGCCGTGGCACTACAAACGCATGGGAAGTCCGTTCATTA 360


17324R-1.IR_full       361 ACCCCATTATGCCCATGAATTTCCTGCCCTACACTGATGAGATGAGTCTGATCGATCGAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17324R-1.in silico     361 ACCCCATTATGCCCATGAATTTCCTGCCCTACACTGATGAGATGAGTCTGATCGATCGAC 420


17324R-1.IR_full       421 TGAATAATTTCTTTCATTTCCACACCGTTAATACTCTGTACAACATGATTACCCAACCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17324R-1.in silico     421 TGAATAATTTCTTTCATTTCCACACCGTTAATACTCTGTACAACATGATTACCCAACCAG 480


17324R-1.IR_full       481 CCACCGATGCCCTGATCGCTGA 502
                           ||||||||||||||||||||||
17324R-1.in silico     481 CCACCGATGCCCTGATCGCTGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136065.3  CG17324-RA (CG17324), mRNA 
0   NM_141960.1  CG11600-RA (CG11600), mRNA 
0   NM_206220.1  CG6845-RB, transcript variant B (CG6845), mRNA 
0   NM_138156.2  CG6845-RA, transcript variant A (CG6845), mRNA 
0   NM_141371.2  CG15592-RA (Osi9), mRNA 
0   NM_138264.1  CG9173-RA (CG9173), mRNA 
0   NM_170232.1  CG5071-RA, transcript variant A (CG5071), mRNA 
0   NM_143149.1  CG5071-RB, transcript variant B (CG5071), mRNA 
0   11  NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_078783.2  CG7068-RA (TepIII), mRNA 
0   32  NM_136066.2  CG17323-RA (CG17323), mRNA 
0   NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_140828.2  CG3797-RA (CG3797), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_168143.1  CG32408-RA (CG32408), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 
0   NM_132479.2  CG1597-RA (CG1597), mRNA 
0   NM_137136.1  CG12866-RA (CG12866), mRNA 
0   NM_057345.2  CG10325-RA, transcript variant A (abd-A), mRNA 
0   NM_169733.2  CG10325-RB, transcript variant B (abd-A), mRNA 
0   NM_141979.1  CG10909-RA (CG10909), mRNA 
0   NM_057938.3  CG3093-RA (dor), mRNA 
0   NM_140905.2  CG7823-RA (RhoGDI), mRNA 
0   NM_144328.2  CG10570-RA (CG10570), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.