National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17321R-3 
 Symbol CG17321  Full Name CG17321 
 CG No CG17321  Old CG No CG17321 
 Synonyms CG17321 
 Accession No (Link to NCBI) NM_136071.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTCTGCTGTCAGCTGGACGA 
 Primer Seq. 3'
aatctagaggtaccGGACAAGCAGTGTGGAGCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGTCTGCTGT CAGCTGGACG ATGAGCAGGA CTTTGAAATA GCTGGCAGCA GGGCCGGCGA 
0061 GCTCTCCCAC TCGCACTCGC ACTCGCTGTC CTTGGAATCC CCCCTCGGAA CCTGCACCTC 
0121 CTGGGACTCC CATGCCAACT ACAAGCAGAG GGGCGGCCAC ACCCCCCTGC CCTgGGGCGT 
0181 CGCCCTTCAC TGTGATCCGC AACACTTGAA ATCGCCTACA GGGATTGTGC GCATACTATT 
0241 GGTGTTATCC TCGGCTGCCT GCCTGGCCTG TGAATGCTCC GCGGGCACCG TACAGGTGGG 
0301 CCTCTTTCTA CTGCCACTCA TCGGACGTCC TGAGGCTGAT GGTCTTCTGC GCGCTCTTTT 
0361 CGCTACTCAT CACGTGTCTC ATGCTCTTTC TGGATATATC GCATATAGCC CTCATGTTCC 
0421 CATTCAACTG GACAAAAGTG AATACGTGGA TGTACCTGAG TGTTGGTTTG ATATTTATTT 
0481 TGAGCTCCAC ACTGCTTGTC C 
 in silico PCR Fragment
0001 GGTCTGCTGT CAGCTGGACG ATGAGCAGGA CTTTGAAATA GCTGGCAGCA GGGCCGGCGA 
0061 GCTCTCCCAC TCGCACTCGC ACTCGCTGTC CTTGGAATCC CCCCTCGGAA CCTGCACCTC 
0121 CTGGGACTCC CATGCCAACT ACAAGCAGAG GGGCGGCCAC ACCCCCCTGC CCTGGGGCGT 
0181 CGCCCTTCAC TGTGATCCGC AACACTTGAA ATCGCCTACA GGGATTGTGC GCATACTATT 
0241 GGTGTTATCC TCGGCTGCCT GCCTGGCCTG TGAATGCTCC GCGGGCACCG TACAGGTGGG 
0301 CCTCTTTCTA CTGCCACTCA TCGGACG-CC TGAGGCTGAT GGTCTTCTGC GCGCTCTTTT 
0361 CGCTACTCAT CACGTGTCTC ATGCTCTTTC TGGATATATC GCATATAGCC CTCATGTTCC 
0421 CATTCAACTG GACAAAAGTG AATACGTGGA TGTACCTGAG TGTTGGTTTG ATATTTATTT 
0481 TGAGCTCCAC ACTGCTTGTC C 
 Assemble Data

17321R-3.IR_full       1   GGTCTGCTGTCAGCTGGACGATGAGCAGGACTTTGAAATAGCTGGCAGCAGGGCCGGCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     1   GGTCTGCTGTCAGCTGGACGATGAGCAGGACTTTGAAATAGCTGGCAGCAGGGCCGGCGA 60


17321R-3.IR_full       61  GCTCTCCCACTCGCACTCGCACTCGCTGTCCTTGGAATCCCCCCTCGGAACCTGCACCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     61  GCTCTCCCACTCGCACTCGCACTCGCTGTCCTTGGAATCCCCCCTCGGAACCTGCACCTC 120


17321R-3.IR_full       121 CTGGGACTCCCATGCCAACTACAAGCAGAGGGGCGGCCACACCCCCCTGCCCTGGGGCGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     121 CTGGGACTCCCATGCCAACTACAAGCAGAGGGGCGGCCACACCCCCCTGCCCTGGGGCGT 180


17321R-3.IR_full       181 CGCCCTTCACTGTGATCCGCAACACTTGAAATCGCCTACAGGGATTGTGCGCATACTATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     181 CGCCCTTCACTGTGATCCGCAACACTTGAAATCGCCTACAGGGATTGTGCGCATACTATT 240


17321R-3.IR_full       241 GGTGTTATCCTCGGCTGCCTGCCTGGCCTGTGAATGCTCCGCGGGCACCGTACAGGTGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     241 GGTGTTATCCTCGGCTGCCTGCCTGGCCTGTGAATGCTCCGCGGGCACCGTACAGGTGGG 300


17321R-3.IR_full       301 CCTCTTTCTACTGCCACTCATCGGACGTCCTGAGGCTGATGGTCTTCTGCGCGCTCTTTT 360
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
17321R-3.in silico     301 CCTCTTTCTACTGCCACTCATCGGACG-CCTGAGGCTGATGGTCTTCTGCGCGCTCTTTT 360


17321R-3.IR_full       361 CGCTACTCATCACGTGTCTCATGCTCTTTCTGGATATATCGCATATAGCCCTCATGTTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     361 CGCTACTCATCACGTGTCTCATGCTCTTTCTGGATATATCGCATATAGCCCTCATGTTCC 420


17321R-3.IR_full       421 CATTCAACTGGACAAAAGTGAATACGTGGATGTACCTGAGTGTTGGTTTGATATTTATTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17321R-3.in silico     421 CATTCAACTGGACAAAAGTGAATACGTGGATGTACCTGAGTGTTGGTTTGATATTTATTT 480


17321R-3.IR_full       481 TGAGCTCCACACTGCTTGTCC 501
                           |||||||||||||||||||||
17321R-3.in silico     481 TGAGCTCCACACTGCTTGTCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_136071.2  CG17321-RA (CG17321), mRNA 
0.2   10  12  NM_079577.3  CG6281-RA, transcript variant A (Timp), mRNA 
0.2   10  12  NM_169336.2  CG6281-RB, transcript variant B (Timp), mRNA 
0.2   NM_166823.1  CG11059-RB, transcript variant B (cals), mRNA 
0   NM_001043266.1  CG34119-RA (CG34119), mRNA 
0   NM_206631.1  CG10706-RF, transcript variant F (SK), mRNA 
0   NM_167029.1  CG10706-RC, transcript variant C (SK), mRNA 
0   NM_167032.1  CG10706-RB, transcript variant B (SK), mRNA 
0   NM_167031.1  CG10706-RA, transcript variant A (SK), mRNA 
0   NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
0   NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
0   NM_167336.1  CG4004-RB, transcript variant B (CG4004), mRNA 
0   NM_132596.1  CG4004-RA, transcript variant A (CG4004), mRNA 
0   NM_140304.2  CG5620-RA, transcript variant A (CG5620), mRNA 
0   NM_206343.1  CG5620-RB, transcript variant B (CG5620), mRNA 
0   NM_139875.3  CG7546-RA, transcript variant A (CG7546), mRNA 
0   NM_168217.2  CG7546-RB, transcript variant B (CG7546), mRNA 
0   NM_165622.1  CG8411-RA (gcl), mRNA 
0   NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
0   NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
0   NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
0   NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   NM_078742.2  CG3289-RA (Ptpa), mRNA 
0   NM_136591.3  CG8213-RA (CG8213), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   11  NM_134553.2  CG1812-RA, transcript variant A (CG1812), mRNA 
0   11  NM_057400.3  CG6993-RA (ss), mRNA 
0   NM_079507.2  CG2530-RA (corto), mRNA 
0   NM_137482.1  CG17525-RA (GstE4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.