National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17320R-3 
 Symbol ScpX  Full Name Sterol carrier protein X-related thiolase 
 CG No CG17320  Old CG No CG17320 
 Synonyms CG17320, ScpX, SCP-x 
 Accession No (Link to NCBI) NM_079976.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGTTGTCGGTGTGGGCATGA 
 Primer Seq. 3'
aatctagaggtaccGCCGAAATGCTCGGGCTTAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGTTGTCGG TGTGGGCATG ACCAAGTTCG AGAAGCCCGG TCGCCGAGCT GATGTGTGCT 
0061 ACCCGGATTT CGCTAGGGAG GCCATCACAA AAGCTCTCCA GGATGCGGGC ATCAAGTACG 
0121 AGGAAGTGCA GCAGGCGGTG GCCGGCTACG TTTATGGAGA CTCCACCTGC GGACAGCGGG 
0181 CCATCTACGA GGTCGGAATG ANCGGCATTC CGGTCTATAA CGTCAACAAC AACTGCTCCA 
0241 CGGGATCCAG TGCTTTGTAT TTGGCCAAGC AGATCGTGGA GAGCGGAAAc GCAGNATTGC 
0301 GTCCTGGCTT TGGGATTTGA AAAGATGGAG CGTGGATCCC TGTCCTCCAA GTACTTTGAT 
0361 CGCGCCAATC CCATGGAGCG TCACATCACC GAGATGGGTG AGCTGGCCGA GATCGGAGCT 
0421 gGNCCAATGG CTGCCCAGAT CtTNGNCAAT GCCGGCAAGG AGCACATGAA GAAGTATGGC 
0481 ACTAAGCCCG AGCATTTCGG C 
 in silico PCR Fragment
0001 ACGTTGTCGG TGTGGGCATG ACCAAGTTCG AGAAGCCCGG TCGCCAAGCT GATGTGTGCT 
0061 ACCCGGATTT CGCTAGGGAG GCCATCACAA AAGCTCTCCA GGATGCGGGC ATCAAGTACG 
0121 AGGAAGTGCA GCAGGCGGTG GCCGGCTACG TTTATGGAGA CTCCACCTGC GGACAGCGGG 
0181 CCATCTACGA GGTCGGAATG ACCGGCATTC CGGTCTATAA CGTCAACAAC AACTGCTCCA 
0241 CGGGATCCAG TGCTTTGTAT TTGGCCAAGC AGATCGTGGA GAGCGGAAAC GCAG-ATTGC 
0301 GTCCTGGCTT TGGGATTTGA AAAGATGGAG CGTGGATCCC TGTCCTCCAA GTACTTTGAT 
0361 CGCGCCAATC CCATGGAGCG TCACATCACC GAGATGGGTG AGCTGGCCGA GATCGGAGCT 
0421 GGCCCAATGG CTGCCCAGAT CTTCGGCAAT GCCGGCAAGG AGCACATGAA GAAGTATGGC 
0481 ACTAAGCCCG AGCATTTCGG C 
 Assemble Data

17320R-3.IR_full       1   ACGTTGTCGGTGTGGGCATGACCAAGTTCGAGAAGCCCGGTCGCCGAGCTGATGTGTGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
17320R-3.in silico     1   ACGTTGTCGGTGTGGGCATGACCAAGTTCGAGAAGCCCGGTCGCCAAGCTGATGTGTGCT 60


17320R-3.IR_full       61  ACCCGGATTTCGCTAGGGAGGCCATCACAAAAGCTCTCCAGGATGCGGGCATCAAGTACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17320R-3.in silico     61  ACCCGGATTTCGCTAGGGAGGCCATCACAAAAGCTCTCCAGGATGCGGGCATCAAGTACG 120


17320R-3.IR_full       121 AGGAAGTGCAGCAGGCGGTGGCCGGCTACGTTTATGGAGACTCCACCTGCGGACAGCGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17320R-3.in silico     121 AGGAAGTGCAGCAGGCGGTGGCCGGCTACGTTTATGGAGACTCCACCTGCGGACAGCGGG 180


17320R-3.IR_full       181 CCATCTACGAGGTCGGAATGANCGGCATTCCGGTCTATAACGTCAACAACAACTGCTCCA 240
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
17320R-3.in silico     181 CCATCTACGAGGTCGGAATGACCGGCATTCCGGTCTATAACGTCAACAACAACTGCTCCA 240


17320R-3.IR_full       241 CGGGATCCAGTGCTTTGTATTTGGCCAAGCAGATCGTGGAGAGCGGAAACGCAGNATTGC 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
17320R-3.in silico     241 CGGGATCCAGTGCTTTGTATTTGGCCAAGCAGATCGTGGAGAGCGGAAACGCAG-ATTGC 300


17320R-3.IR_full       301 GTCCTGGCTTTGGGATTTGAAAAGATGGAGCGTGGATCCCTGTCCTCCAAGTACTTTGAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17320R-3.in silico     301 GTCCTGGCTTTGGGATTTGAAAAGATGGAGCGTGGATCCCTGTCCTCCAAGTACTTTGAT 360


17320R-3.IR_full       361 CGCGCCAATCCCATGGAGCGTCACATCACCGAGATGGGTGAGCTGGCCGAGATCGGAGCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17320R-3.in silico     361 CGCGCCAATCCCATGGAGCGTCACATCACCGAGATGGGTGAGCTGGCCGAGATCGGAGCT 420


17320R-3.IR_full       421 GGNCCAATGGCTGCCCAGATCTTNGNCAATGCCGGCAAGGAGCACATGAAGAAGTATGGC 480
                           || |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||
17320R-3.in silico     421 GGCCCAATGGCTGCCCAGATCTTCGGCAATGCCGGCAAGGAGCACATGAAGAAGTATGGC 480


17320R-3.IR_full       481 ACTAAGCCCGAGCATTTCGGC 501
                           |||||||||||||||||||||
17320R-3.in silico     481 ACTAAGCCCGAGCATTTCGGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079976.3  CG17320-RA (ScpX), mRNA 
29.87   144  151  95  63  NM_136068.2  CG17597-RA (CG17597), mRNA 
0   NM_142438.2  CG7168-RA (CG7168), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   12  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_137101.2  CG8531-RA (CG8531), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_057560.3  CG17369-RB, transcript variant B (Vha55), mRNA 
0   NM_169475.1  CG17369-RA, transcript variant A (Vha55), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_166844.1  CG17896-RA, transcript variant A (CG17896), mRNA 
0   NM_130489.2  CG17896-RB, transcript variant B (CG17896), mRNA 
0   NM_136935.1  CG8834-RA (CG8834), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_139398.1  CG7995-RA, transcript variant A (CG7995), mRNA 
0   NM_137613.2  CG11099-RA (CG11099), mRNA 
0   NM_132528.1  CG1886-RA (ATP7), mRNA 
0   12  23  NM_167006.1  CG32774-RA (CG32774), mRNA 
0   NM_135750.1  CG16800-RA (CG16800), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   18  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_137296.2  CG8306-RA (CG8306), mRNA 
0   NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0   NM_164971.1  CG14938-RD, transcript variant D (crol), mRNA 
0   NM_137988.2  CG5543-RA (CG5543), mRNA 
0   NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0   NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.