National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17300R-1 
 Symbol CG17300  Full Name CG17300 
 CG No CG17300  Old CG No CG17300 
 Synonyms CG17300 
 Accession No (Link to NCBI) NM_140374.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAGCCTTACGTCCTTTGACTG 
 Primer Seq. 3'
aatctagaggtaccGGATCCTTATTTCCGTTCGAG 
 Predicted Fragment Size
415 
 IR fragment full Seq
0001 TANGCCTTAC GTCCTTTGAC TGTGGCCACA TCTCGTTCGG CTACCACCCA TTCCGCCCAA 
0061 GGACTAAGTA GGCTCCCTGG GCATGGAAGT CCCGGAAAGG TTCGCCCGGG TTTCCCGTCC 
0121 GACAATTGGG TTAAAGGACC CATGGGCGTC GGCCTGNTTG GCATATATCT GTTCCGGAGA 
0181 CTGTTGCGCC ATTAAGCACG AGCACAGCGG CCTATCCTTG GGCATCATGG AAGATGGCTA 
0241 CTACAGCAGT GGAATCACCA TCGGTATCCT GACCACATTT GCTGTGATTA GGCTTCTTCC 
0301 AGCGATTGTA AAGTGGGCTG ATAGCGAGAT TATTAAAATT GAGTCCGAGT ACGAAAAGAG 
0361 TCGTGAAACT AAGATCAAGG TCCTATCAAT CTCGCCCTCG AACGGAAATA AGGATCC 
 in silico PCR Fragment
0001 TA-GCCTTAC GTCCTTTGAC TGTGGCCACA TCTCGTTCGG CTACCACCCA TTCCGCCCAA 
0061 GGACTAAGTA GGCTCCCTGG GCATGGAAGT CCCGGAAAGG TTCGCCCGGG TTTCCCGTCC 
0121 GACAATTGGG TTAAAGGACC CATGGGCGTC GGCCTG-TTG GCATATATCT GTTCCGGAGA 
0181 CTGTTGCGCC ATTAAGCACG AGCACAGCGG CCTATCCTTG GGCATCATGG AAGATGGCTA 
0241 CTACAGCAGT GGAATCACCA TCGGTATCCT GACCACATTT GCTGTGATTA GGCTTCTTCC 
0301 AGCGATTGTA AAGTGGGCTG ATAGCGAGAT TATTAAAATT GAGTCCGAGT ACGAAAAGAG 
0361 TCGTGAAACT AAGATCAAGG TCCTATCAAT CTCGCCCTCG AACGGAAATA AGGATCC 
 Assemble Data

17300R-1.IR_full       1   TANGCCTTACGTCCTTTGACTGTGGCCACATCTCGTTCGGCTACCACCCATTCCGCCCAA 60
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17300R-1.in silico     1   TA-GCCTTACGTCCTTTGACTGTGGCCACATCTCGTTCGGCTACCACCCATTCCGCCCAA 60


17300R-1.IR_full       61  GGACTAAGTAGGCTCCCTGGGCATGGAAGTCCCGGAAAGGTTCGCCCGGGTTTCCCGTCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17300R-1.in silico     61  GGACTAAGTAGGCTCCCTGGGCATGGAAGTCCCGGAAAGGTTCGCCCGGGTTTCCCGTCC 120


17300R-1.IR_full       121 GACAATTGGGTTAAAGGACCCATGGGCGTCGGCCTGNTTGGCATATATCTGTTCCGGAGA 180
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
17300R-1.in silico     121 GACAATTGGGTTAAAGGACCCATGGGCGTCGGCCTG-TTGGCATATATCTGTTCCGGAGA 180


17300R-1.IR_full       181 CTGTTGCGCCATTAAGCACGAGCACAGCGGCCTATCCTTGGGCATCATGGAAGATGGCTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17300R-1.in silico     181 CTGTTGCGCCATTAAGCACGAGCACAGCGGCCTATCCTTGGGCATCATGGAAGATGGCTA 240


17300R-1.IR_full       241 CTACAGCAGTGGAATCACCATCGGTATCCTGACCACATTTGCTGTGATTAGGCTTCTTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17300R-1.in silico     241 CTACAGCAGTGGAATCACCATCGGTATCCTGACCACATTTGCTGTGATTAGGCTTCTTCC 300


17300R-1.IR_full       301 AGCGATTGTAAAGTGGGCTGATAGCGAGATTATTAAAATTGAGTCCGAGTACGAAAAGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17300R-1.in silico     301 AGCGATTGTAAAGTGGGCTGATAGCGAGATTATTAAAATTGAGTCCGAGTACGAAAAGAG 360


17300R-1.IR_full       361 TCGTGAAACTAAGATCAAGGTCCTATCAATCTCGCCCTCGAACGGAAATAAGGATCC 417
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17300R-1.in silico     361 TCGTGAAACTAAGATCAAGGTCCTATCAATCTCGCCCTCGAACGGAAATAAGGATCC 417

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   397  NM_140374.1  CG17300-RA (CG17300), mRNA 
0.5   NM_132438.1  CG11203-RA (CG11203), mRNA 
0   NM_079084.2  CG13495-RA (Gr58b), mRNA 
0   NM_057614.2  CG4926-RA (Ror), mRNA 
0   NM_140155.2  CG7958-RA, transcript variant A (tna), mRNA 
0   NM_168422.1  CG7958-RB, transcript variant B (tna), mRNA 
0   NM_167644.1  CG32536-RA (CG32536), mRNA 
0   NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
0   NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
0   NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_079287.1  CG5799-RB, transcript variant B (dve), mRNA, subunit b CG8189-RA, transcript variant A (ATPsyn-b), mRNA 
0   NM_168365.1  CG5799-RB, transcript variant B (dve), mRNA, subunit b CG8189-RA, transcript variant A (ATPsyn-b), mRNA, subunit b CG8189-RB, transcript variant B (ATPsyn-b), mRNA 
0   NM_135791.1  CG15639-RA (CG15639), mRNA 
0   NM_166914.1  CG3810-RA, transcript variant A (CG3810), mRNA 
0   NM_130603.2  CG3810-RB, transcript variant B (CG3810), mRNA 
0   NM_136188.2  CG10949-RA (CG10949), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_142273.2  CG12785-RA (CG12785), mRNA 
0   NM_137323.3  CG8910-RA (CG8910), mRNA 
0   NM_169203.1  CG11094-RB, transcript variant B (dsx), mRNA 
0   NM_079548.4  CG11094-RC, transcript variant C (dsx), mRNA 
0   NM_137585.2  CG11007-RA (CG11007), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
0   NM_164617.1  CG4145-RC, transcript variant C (Cg25C), mRNA 
0   NM_164615.1  CG4145-RA, transcript variant A (Cg25C), mRNA 
0   NM_164616.1  CG4145-RB, transcript variant B (Cg25C), mRNA 
0   NM_135191.2  CG9537-RA (DLP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.