National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17285R-6 
 Symbol Fbp1  Full Name Fat body protein 1 
 CG No CG17285  Old CG No CG17285 
 Synonyms fbp1, Fbp-1, CG17285, fbp-1, P1, DmeFBP1, Fbp1 
 Accession No (Link to NCBI) NM_079341.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCAGACAGTCAGCGTTATCG 
 Primer Seq. 3'
aatctagaggtaccCGTTCTGGATGTTCTGCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCAGACAGT CAGCGTTATC GTGGCGGCAT TGATAAGGTG ATGCATAACG TCATCGATCT 
0061 GGATCGCCAG CGTCGCCTCC TCGACGAGCA CCAGGTGTAC TCCGTGGGTC GTTTGGAGCA 
0121 TGTGCAGCAG CNTGCGTNGG CATATACCGC CTGCTGGCTG CGCGCCCAGG ACTTTGACAC 
0181 CCTTCGCCGT AATGTGGTCT ACCTGCGCCG TAACATTAAC CCTGTCCTGC TGGTTAATGC 
0241 CTTGGCTCTG GCCATTCGCG ATCGTGAGGA CACTCAAGCT CTGATCGTGC CCGCTGTCCA 
0301 GGAGCTGCTC CCCGAACTGT ATCTGGNATG AGGAAGTGAT TCAGCAGGTg CGCAGCGTCC 
0361 NTAAGGGAAC AAACCCAGCG CCCATCGCTC ATGGACATCG TGGGTATNGC GCCAGCGGGC 
0421 TATGAACCCA GTGATGAGCA TCCTGATGNC CTGGAGGGAG ATCCACATGC AGATGGCTCT 
0481 AAGGAAACAG CAGAACATCC AGAACG 
 in silico PCR Fragment
0001 TGCAGACAGT CAGCGTTATC GTGGCGGCAT TGATAAGGTG ATGCATAACG TCATCGATCT 
0061 GGATCGCCAG CGTCGCCTCC TCGACGAGCA CCAGGTGTAC TCCGTGGGTC GTTTGGAGCA 
0121 TGTGCAGCAG C-TGCGT-GG CATATACCGC CTGCTGGCT- CGCGCCCAGG ACTTTGACAC 
0181 CCTTCGCCGT AATGTGGTCT ACCTGCGCCG TAACATTAAC CCTGTCCTGC TGGTTAATGC 
0241 CTTGGCTCTG GCCATTCGCG ATCGTGAGGA CACTCAAGCT CTGATCGTGC CCGCTGTCCA 
0301 GGAGCTGCTC CCCGAACTGT ATCTGG-ATG AGGAAGTGAT TCAGCAGGTG CGCAGCGTCC 
0361 -TAAGGGAAC AAACCCAGCG CCCATCGCTC ATGGACATCG TGGGTAT-GC GCCAGCGGGC 
0421 TATGAACCCA GTGATGAGCA TCCTGATGCC CTGGAGGGAG ATCCACATGC AGATGGCTCT 
0481 AAGGAAACAG CAGAACATCC AGAACG 
 Assemble Data

17285R-6.IR_full       1   TGCAGACAGTCAGCGTTATCGTGGCGGCATTGATAAGGTGATGCATAACGTCATCGATCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17285R-6.in silico     1   TGCAGACAGTCAGCGTTATCGTGGCGGCATTGATAAGGTGATGCATAACGTCATCGATCT 60


17285R-6.IR_full       61  GGATCGCCAGCGTCGCCTCCTCGACGAGCACCAGGTGTACTCCGTGGGTCGTTTGGAGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17285R-6.in silico     61  GGATCGCCAGCGTCGCCTCCTCGACGAGCACCAGGTGTACTCCGTGGGTCGTTTGGAGCA 120


17285R-6.IR_full       121 TGTGCAGCAGCNTGCGTNGGCATATACCGCCTGCTGGCTGCGCGCCCAGGACTTTGACAC 180
                           ||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||
17285R-6.in silico     121 TGTGCAGCAGC-TGCGT-GGCATATACCGCCTGCTGGCT-CGCGCCCAGGACTTTGACAC 180


17285R-6.IR_full       181 CCTTCGCCGTAATGTGGTCTACCTGCGCCGTAACATTAACCCTGTCCTGCTGGTTAATGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17285R-6.in silico     181 CCTTCGCCGTAATGTGGTCTACCTGCGCCGTAACATTAACCCTGTCCTGCTGGTTAATGC 240


17285R-6.IR_full       241 CTTGGCTCTGGCCATTCGCGATCGTGAGGACACTCAAGCTCTGATCGTGCCCGCTGTCCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17285R-6.in silico     241 CTTGGCTCTGGCCATTCGCGATCGTGAGGACACTCAAGCTCTGATCGTGCCCGCTGTCCA 300


17285R-6.IR_full       301 GGAGCTGCTCCCCGAACTGTATCTGGNATGAGGAAGTGATTCAGCAGGTGCGCAGCGTCC 360
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
17285R-6.in silico     301 GGAGCTGCTCCCCGAACTGTATCTGG-ATGAGGAAGTGATTCAGCAGGTGCGCAGCGTCC 360


17285R-6.IR_full        361 TAAGGGAACAAACCCAGCGCCCATCGCTCATGGACATCGTGGGTATNGCGCCAGCGGGC 419
                            |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
17285R-6.in silico      361 TAAGGGAACAAACCCAGCGCCCATCGCTCATGGACATCGTGGGTAT-GCGCCAGCGGGC 419


17285R-6.IR_full       421 TATGAACCCAGTGATGAGCATCCTGATGNCCTGGAGGGAGATCCACATGCAGATGGCTCT 479
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
17285R-6.in silico     421 TATGAACCCAGTGATGAGCATCCTGATGCCCTGGAGGGAGATCCACATGCAGATGGCTCT 479


17285R-6.IR_full       481 AAGGAAACAGCAGAACATCCAGAACG 505
                           ||||||||||||||||||||||||||
17285R-6.in silico     481 AAGGAAACAGCAGAACATCCAGAACG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168578.1  CG17285-RB, transcript variant B (Fbp1), mRNA 
100   482  NM_079341.1  CG17285-RA, transcript variant A (Fbp1), mRNA 
0   NM_080377.2  CG10207-RA (NaPi-T), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   NM_165203.1  CG31784-RA, transcript variant A (CG31784), mRNA 
0   NM_165204.1  CG31784-RB, transcript variant B (CG31784), mRNA 
0   NM_176718.1  CG9113-RD, transcript variant D (AP-1gamma), mRNA 
0   NM_167178.2  CG9113-RB, transcript variant B (AP-1gamma), mRNA 
0   NM_176717.1  CG9113-RC, transcript variant C (AP-1gamma), mRNA 
0   NM_132299.3  CG9113-RA, transcript variant A (AP-1gamma), mRNA 
0   NM_206671.1  CG9113-RE, transcript variant E (AP-1gamma), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_176000.1  CG32984-RA (CG32984), mRNA 
0   NM_142000.2  CG7769-RA (DDB1), mRNA 
0   NM_080019.2  CG9943-RA (Surf1), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_057573.3  CG5352-RA (SmB), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 
0   NM_205945.1  CG3811-RD, transcript variant D (Oatp30B), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_169854.1  CG31212-RA (CG31212), mRNA 
0   NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.