National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17285R-2 
 Symbol Fbp1  Full Name Fat body protein 1 
 CG No CG17285  Old CG No CG17285 
 Synonyms fbp1, Fbp-1, CG17285, fbp-1, P1, DmeFBP1, Fbp1 
 Accession No (Link to NCBI) NM_079341.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCAGACAGTCAGCGTTATCGTGGCGGCATTGATAAGGTGATGCATAACGTCATCGATCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGATCGCCAGCGTCGCCTCCTCGACGAGCACCAGGTGTACTCCGTGGGTCGTTTGGAGCA 120

                           ||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||| silico     121 TGTGCAGCAGC-TGCGT-GGCATATACCGCCTGCTGGCT-CGCGCCCAGGACTTTGACAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCTTCGCCGTAATGTGGTCTACCTGCGCCGTAACATTAACCCTGTCCTGCTGGTTAATGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTTGGCTCTGGCCATTCGCGATCGTGAGGACACTCAAGCTCTGATCGTGCCCGCTGTCCA 300

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     301 GGAGCTGCTCCCCGAACTGTATCTGG-ATGAGGAAGTGATTCAGCAGGTGCGCAGCGTCC 360

                            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico      361 TAAGGGAACAAACCCAGCGCCCATCGCTCATGGACATCGTGGGTAT-GCGCCAGCGGGC 419

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     421 TATGAACCCAGTGATGAGCATCCTGATGCCCTGGAGGGAGATCCACATGCAGATGGCTCT 479

                           |||||||||||||||||||||||||| silico     481 AAGGAAACAGCAGAACATCCAGAACG 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168578.1  CG17285-RB, transcript variant B (Fbp1), mRNA 
100   482  NM_079341.1  CG17285-RA, transcript variant A (Fbp1), mRNA 
0   NM_080377.2  CG10207-RA (NaPi-T), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   NM_165203.1  CG31784-RA, transcript variant A (CG31784), mRNA 
0   NM_165204.1  CG31784-RB, transcript variant B (CG31784), mRNA 
0   NM_176718.1  CG9113-RD, transcript variant D (AP-1gamma), mRNA 
0   NM_167178.2  CG9113-RB, transcript variant B (AP-1gamma), mRNA 
0   NM_176717.1  CG9113-RC, transcript variant C (AP-1gamma), mRNA 
0   NM_132299.3  CG9113-RA, transcript variant A (AP-1gamma), mRNA 
0   NM_206671.1  CG9113-RE, transcript variant E (AP-1gamma), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_176000.1  CG32984-RA (CG32984), mRNA 
0   NM_142000.2  CG7769-RA (DDB1), mRNA 
0   NM_080019.2  CG9943-RA (Surf1), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_057573.3  CG5352-RA (SmB), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 
0   NM_205945.1  CG3811-RD, transcript variant D (Oatp30B), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_169854.1  CG31212-RA (CG31212), mRNA 
0   NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.