National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17245R-2 
 Symbol plexB  Full Name plexin B 
 CG No CG17245  Old CG No CG17245 
 Synonyms PlexB, plex, unnamed, CG17245, plexB 
 Accession No (Link to NCBI) NM_079877.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGGTTCTCAGCATTATTGCGTTAACTGCATTGAAGAACTGCCGGCTCAGGCGTTATCTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCTTAAATGACATAGTCGCCCAGTTTAACTTGCCATCAATACCAGTTCAATCAACAGCTT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAGCTATGGCAATCGATCAATTGGAAACAATATAGAAAGTGTTAGAGACTCTCAATCTA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAAATTATTTTACTCACATGAGCTTCGACTTTATGCACAATGTTTTGTTTGCGGGTGCTA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAAATAAAATACTTAAACTTAACGAAAACCTTCGAGTGCTGGCCGAGGCTGTTACTGGGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTTACATGATTCCCCGCAATGTCACGCTGGAGGCTGTCCGGAAGATATTGAGACATCGC 360

                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     361 TTGTCAATAACTTCAACAAAATTCTAGTA-GTAAGCTACGCTCACGATGGTATTCTCATA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCGTGTGGAAGCATTCGACAAGGAGCCTGCGAAATTTACAGCCTGCCACGTTTTCCGGCA 480

17245R-2.IR_full       481 ACGCCCCAGTTTTTTGCAGTT 501
                           ||||||||||||||||||||| silico     481 ACGCCCCAGTTTTTTGCAGTT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079877.2  CG17245-RA (plexB), mRNA 
0   NM_143432.2  CG31445-RA (CG31445), mRNA 
0   NM_132859.2  CG9066-RA (CG9066), mRNA 
0   12  NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   NM_078740.2  CG8817-RB, transcript variant B (lilli), mRNA 
0   NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   NM_143567.3  CG11315-RA, transcript variant A (CG11315), mRNA 
0   NM_170521.2  CG11315-RB, transcript variant B (CG11315), mRNA 
0   NM_141562.1  CG11760-RB, transcript variant B (CG11760), mRNA 
0   NM_169236.1  CG11760-RA, transcript variant A (CG11760), mRNA 
0   NM_057515.2  CG6518-RA (inaC), mRNA 
0   NM_176153.1  CG33013-RB (CG33013), mRNA 
0   NM_142034.1  CG9764-RA (yrt), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_167821.1  CG32476-RA (mthl14), mRNA 
0   NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
0   NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
0   NM_140048.2  CG4080-RA (CG4080), mRNA 
0   NM_135355.2  CG8282-RA (Snx6), mRNA 
0   NM_141289.2  CG2519-RA, transcript variant A (CG2519), mRNA 
0   NM_139791.1  CG10144-RA (CG10144), mRNA 
0   NM_168773.1  CG4144-RC, transcript variant C (GNBP2), mRNA 
0   NM_079417.2  CG4144-RB, transcript variant B (GNBP2), mRNA 
0   NM_168772.1  CG4144-RD, transcript variant D (GNBP2), mRNA 
0   NM_168771.1  CG4144-RA, transcript variant A (GNBP2), mRNA 
0   NM_136807.1  CG13226-RA (CG13226), mRNA 
0   NM_166704.1  CG15792-RB, transcript variant B (zip), mRNA 
0   NM_001014553.1  CG15792-RC, transcript variant C (zip), mRNA 
0   NM_079136.2  CG15792-RA, transcript variant A (zip), mRNA 
0   NM_001014552.1  CG15792-RD, transcript variant D (zip), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.