National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17245-3R-2 
 Symbol plexB  Full Name plexin B 
 CG No CG17245  Old CG No CG17245 
 Synonyms PlexB, plex, unnamed, CG17245, plexB 
 Accession No (Link to NCBI) NM_079877.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGTCACCACATTCGTTAAG 
 Primer Seq. 3'
aatctagaggtaccACGACCAGAAGTGCTACCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACGTCACCA CATTCGTTAA GGTTCATGAA ACTCAATTAA ACTTACAACT AAGTTTTGTA 
0061 ATGGACAATG TACAACTAGT TCGAAACTTG AATAAATATT TTCATGACAT AAGGAGCACT 
0121 ATTGTCTATT TAGCAGACCC AAAATATTTG CCATTTCCCA ACGACGGCGT TAAACTCTAC 
0181 AAGGGTGACA GCTTGGTCAT AGAAGGCGAG CTATTAAACT TGGCAGCTGA TGAGTACGAT 
0241 GTAAATGTAA CTATTGGAAC TTCCCAATGC AATATTACCA GCCTGGCACT TAACCAACTT 
0301 TTATGCATTC CGCCGGAGCA ACAACCACTT CCAACTGATG AAAATGGTGT GGATCAATCA 
0361 ACTGATTTAC CTCTTGTTGT CGTTAAAGTA GGTCGAAATC TTCGTTTTGT AATAGGATAT 
0421 CTTAAGTATG ATTTAAATAA ACCCTATGTT TTCTCACATG CCTTGTTAGT CGGCATATTA 
0481 ACGGTAGCAC TTCTGGTCGT  
 in silico PCR Fragment
0001 GACGTCACCA CATTCGTTAA GGTTCATGAA ACTCAATTAA ACTTACAACT AAGTTTTGTA 
0061 ATGGACAATG TACAACTAGT TCGAAACTTG AATAAATATT TTCATGACAT AAGGAGCACT 
0121 ATTGTCTATT TAGCAGACCC AAAATATTTG CCATTTCCCA ACGACGGCGT TAAACTCTAC 
0181 AAGGGTGACA GCTTGGTCAT AGAAGGCGAG CTATTAAACT TGGCAGCTGA TGAGTACGAT 
0241 GTAAATGTAA CTATTGGAAC TTCCCAATGC AATATTACCA GCCTGGCACT TAACCAACTT 
0301 TTATGCATTC CGCCGGAGCA ACAACCACTT CCAACTGATG AAAATGGTGT GGATCAATCA 
0361 ACTGATTTAC CTCTTGTTGT CGTTAAAGTA GGTCGAAATC TTCGTTTTGT AATAGGATAT 
0421 CTTAAGTATG ATTTAAATAA ACCCTATGTT TTCTCACATG CCTTGTTAGT CGGCATATTA 
0481 ACGGTAGCAC TTCTGGTCGT  
 Assemble Data

17245-3R-2.IR_full       1   GACGTCACCACATTCGTTAAGGTTCATGAAACTCAATTAAACTTACAACTAAGTTTTGTA 60
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     1   GACGTCACCACATTCGTTAAGGTTCATGAAACTCAATTAAACTTACAACTAAGTTTTGTA 60


17245-3R-2.IR_full       61  ATGGACAATGTACAACTAGTTCGAAACTTGAATAAATATTTTCATGACATAAGGAGCACT 120
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     61  ATGGACAATGTACAACTAGTTCGAAACTTGAATAAATATTTTCATGACATAAGGAGCACT 120


17245-3R-2.IR_full       121 ATTGTCTATTTAGCAGACCCAAAATATTTGCCATTTCCCAACGACGGCGTTAAACTCTAC 180
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     121 ATTGTCTATTTAGCAGACCCAAAATATTTGCCATTTCCCAACGACGGCGTTAAACTCTAC 180


17245-3R-2.IR_full       181 AAGGGTGACAGCTTGGTCATAGAAGGCGAGCTATTAAACTTGGCAGCTGATGAGTACGAT 240
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     181 AAGGGTGACAGCTTGGTCATAGAAGGCGAGCTATTAAACTTGGCAGCTGATGAGTACGAT 240


17245-3R-2.IR_full       241 GTAAATGTAACTATTGGAACTTCCCAATGCAATATTACCAGCCTGGCACTTAACCAACTT 300
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     241 GTAAATGTAACTATTGGAACTTCCCAATGCAATATTACCAGCCTGGCACTTAACCAACTT 300


17245-3R-2.IR_full       301 TTATGCATTCCGCCGGAGCAACAACCACTTCCAACTGATGAAAATGGTGTGGATCAATCA 360
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     301 TTATGCATTCCGCCGGAGCAACAACCACTTCCAACTGATGAAAATGGTGTGGATCAATCA 360


17245-3R-2.IR_full       361 ACTGATTTACCTCTTGTTGTCGTTAAAGTAGGTCGAAATCTTCGTTTTGTAATAGGATAT 420
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     361 ACTGATTTACCTCTTGTTGTCGTTAAAGTAGGTCGAAATCTTCGTTTTGTAATAGGATAT 420


17245-3R-2.IR_full       421 CTTAAGTATGATTTAAATAAACCCTATGTTTTCTCACATGCCTTGTTAGTCGGCATATTA 480
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-3R-2.in silico     421 CTTAAGTATGATTTAAATAAACCCTATGTTTTCTCACATGCCTTGTTAGTCGGCATATTA 480


17245-3R-2.IR_full       481 ACGGTAGCACTTCTGGTCGT 500
                             ||||||||||||||||||||
17245-3R-2.in silico     481 ACGGTAGCACTTCTGGTCGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NR_001598.1  CR32009, mRNA 
96.05   463  19  NM_079877.2  CG17245-RA (plexB), mRNA 
92.11   444  38  NR_001597.1  CR32010, mRNA 
63.27   305  NR_001596.1  CR32011, mRNA 
0.2   NM_132008.3  CG32763-RA (l(1)G0045), mRNA 
0   NM_078684.2  CG3291-RA (pcm), mRNA 
0   NM_142570.2  CG7535-RA, transcript variant A (GluClalpha), mRNA 
0   NM_140685.4  CG3799-RA, transcript variant A (CG3799), mRNA 
0   NM_168706.1  CG3799-RC, transcript variant C (CG3799), mRNA 
0   NM_168705.1  CG3799-RB, transcript variant B (CG3799), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   NM_169997.3  CG31163-RB, transcript variant B (CG31163), mRNA 
0   NM_078990.2  CG8821-RA, transcript variant A (vis), mRNA 
0   NM_176157.1  CG8821-RB, transcript variant B (vis), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0   NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 
0   NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0   NM_140987.2  CG4786-RA (CG4786), mRNA 
0   NM_168966.1  CG32462-RA (CG32462), mRNA 
0   NM_134685.2  CG4427-RB, transcript variant B (cbt), mRNA 
0   NM_164384.1  CG4427-RA, transcript variant A (cbt), mRNA 
0   NM_057923.2  CG6708-RA (Osbp), mRNA 
0   NM_143057.2  CG11771-RA (CG11771), mRNA 
0   NM_135255.1  CG13783-RA (CG13783), mRNA 
0   NM_168897.1  CG32439-RA (CG32439), mRNA 
0   NM_169633.2  CG4898-RB, transcript variant B (Tm1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.