National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17245-2R-2 
 Symbol plexB  Full Name plexin B 
 CG No CG17245  Old CG No CG17245 
 Synonyms PlexB, plex, unnamed, CG17245, plexB 
 Accession No (Link to NCBI) NM_079877.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGTCTACAAAGTTCCTGGGG 
 Primer Seq. 3'
aatctagaggtaccTCCGTGGTAATGGGCACTCGT 
 Predicted Fragment Size
593 
 IR fragment full Seq
0001 GTGTCTACAA AGTTCCTGGG GTTGCAACTG GTGTATTTTT GATAATAAGT GCGTTCACAA 
0061 GTCTTTGCAA TGCCGTAACA TAGAAAATGC TGTAAGTACT GTTGGTCACT GCCCCCACTT 
0121 AAAAAAAAAT CGTCCGGAAA TACTTCTACC CGTAAGAGTG CCAATAGAAA TTCGGCTAGA 
0181 GATTGAAAAT TTACCAAAAC CCAAGAGCGC ACATGCTGGT TTTTTATGTG ACAATACATA 
0241 TTGAAGCTGC TCAGATGCTA CTCCCTGCTC ACGTTGAGTC AAATAAAATT GTAGTTTGCG 
0301 AAAAAACACC ATATTTCTAC GAGATTAATA CACATGAATA TCAGGCGAAG GTTGTAGTTA 
0361 CATGGAACTT CCAGCATTAT GTGGACACCG CAATTGTTAC ATTATACAAG TGTGACGTGT 
0421 TGGGCTCCCA TCGGGAACAC CCTGATTGCA GTTTGTGCGT AACTCGAGAT CCAAAATATA 
0481 AATGTGCTTG GTGCAGCAAC TCATGTGTAT ATAATGAAAC TTGCATAGCT GATAAAAATT 
0541 CTATCAGCTC AGGATCTAAA TCCGCTATAG AAAACGAGTG CCCATTACCA CGGA 
 in silico PCR Fragment
0001 GTGTCTACAA AGTTCCTGGG GTTGCAACTG GTGTATTTTT GATAATAAGT GCGTTCACAA 
0061 GTCTTTGCAA TGCCGTAACA TAGAAAATGC TGTAAGTACT GTTGGTCACT GCCCCCACTT 
0121 AAAAAAAAAT CGTCCGGAAA TACTTCTACC CGTAAGAGTG CCAATAGAAA TTCGGCTAGA 
0181 GATTGAAAAT TTACCAAAAC CCAAGAGCGC ACATGCTGGT TTTTTATGT- ACAATACATA 
0241 TTGAAGCTGC TCAGATGCTA CTCCCTGCTC ACGTTGAGTC AAATAAAATT GTAGTTTGCG 
0301 AAAAAACACC ATATTTCTAC GAGATTAATA CACATGAATA TCAGGCGAAG GTTGTAGTTA 
0361 CATGGAACTT CCAGCATTAT GTGGACACCG CAATTGTTAC ATTATACAAG TGTGACGTGT 
0421 TGGGCTCCCA TCGGGAACAC CCTGATTGCA GTTTGTGCGT AACTCGAGAT CCAAAATATA 
0481 AATGTGCTTG GTGCAGCAAC TCATGTGTAT ATAATGAAAC TTGCATAGCT GATAAAAATT 
0541 CTATCAGCTC AGGATCTAAA TCCGCTATAG AAAACGAGTG CCCATTACCA CGGA 
 Assemble Data

17245-2R-2.IR_full       1   GTGTCTACAAAGTTCCTGGGGTTGCAACTGGTGTATTTTTGATAATAAGTGCGTTCACAA 60
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     1   GTGTCTACAAAGTTCCTGGGGTTGCAACTGGTGTATTTTTGATAATAAGTGCGTTCACAA 60


17245-2R-2.IR_full       61  GTCTTTGCAATGCCGTAACATAGAAAATGCTGTAAGTACTGTTGGTCACTGCCCCCACTT 120
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     61  GTCTTTGCAATGCCGTAACATAGAAAATGCTGTAAGTACTGTTGGTCACTGCCCCCACTT 120


17245-2R-2.IR_full       121 AAAAAAAAATCGTCCGGAAATACTTCTACCCGTAAGAGTGCCAATAGAAATTCGGCTAGA 180
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     121 AAAAAAAAATCGTCCGGAAATACTTCTACCCGTAAGAGTGCCAATAGAAATTCGGCTAGA 180


17245-2R-2.IR_full       181 GATTGAAAATTTACCAAAACCCAAGAGCGCACATGCTGGTTTTTTATGTGACAATACATA 240
                             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
17245-2R-2.in silico     181 GATTGAAAATTTACCAAAACCCAAGAGCGCACATGCTGGTTTTTTATGT-ACAATACATA 240


17245-2R-2.IR_full       241 TTGAAGCTGCTCAGATGCTACTCCCTGCTCACGTTGAGTCAAATAAAATTGTAGTTTGCG 300
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     241 TTGAAGCTGCTCAGATGCTACTCCCTGCTCACGTTGAGTCAAATAAAATTGTAGTTTGCG 300


17245-2R-2.IR_full       301 AAAAAACACCATATTTCTACGAGATTAATACACATGAATATCAGGCGAAGGTTGTAGTTA 360
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     301 AAAAAACACCATATTTCTACGAGATTAATACACATGAATATCAGGCGAAGGTTGTAGTTA 360


17245-2R-2.IR_full       361 CATGGAACTTCCAGCATTATGTGGACACCGCAATTGTTACATTATACAAGTGTGACGTGT 420
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     361 CATGGAACTTCCAGCATTATGTGGACACCGCAATTGTTACATTATACAAGTGTGACGTGT 420


17245-2R-2.IR_full       421 TGGGCTCCCATCGGGAACACCCTGATTGCAGTTTGTGCGTAACTCGAGATCCAAAATATA 480
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     421 TGGGCTCCCATCGGGAACACCCTGATTGCAGTTTGTGCGTAACTCGAGATCCAAAATATA 480


17245-2R-2.IR_full       481 AATGTGCTTGGTGCAGCAACTCATGTGTATATAATGAAACTTGCATAGCTGATAAAAATT 540
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     481 AATGTGCTTGGTGCAGCAACTCATGTGTATATAATGAAACTTGCATAGCTGATAAAAATT 540


17245-2R-2.IR_full       541 CTATCAGCTCAGGATCTAAATCCGCTATAGAAAACGAGTGCCCATTACCACGGA 594
                             ||||||||||||||||||||||||||||||||||||||||||||||||||||||
17245-2R-2.in silico     541 CTATCAGCTCAGGATCTAAATCCGCTATAGAAAACGAGTGCCCATTACCACGGA 594

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NR_001597.1  CR32010, mRNA 
96.05   463  19  NR_001596.1  CR32011, mRNA 
92.32   445  22  NM_079877.2  CG17245-RA (plexB), mRNA 
0   NM_168365.1  CG17245-RA (plexB), mRNA, subunit b CG8189-RB, transcript variant B (ATPsyn-b), mRNA 
0   NM_143531.1  CG15535-RA (CG15535), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_132196.2  CG10777-RB (CG10777), mRNA 
0   NM_166765.1  CG11533-RC, transcript variant C (Asator), mRNA 
0   NM_166766.1  CG11533-RB, transcript variant B (Asator), mRNA 
0   NM_143667.1  CG11533-RA, transcript variant A (Asator), mRNA 
0   NM_079649.2  CG18740-RA (mor), mRNA 
0   NM_168477.1  CG32092-RB (CG32092), mRNA 
0   NM_001042978.1  CG17484-RB, transcript variant B (p120ctn), mRNA 
0   NM_167364.1  CG15747-RA (CG15747), mRNA 
0   NM_134521.2  CG17003-RA (CG17003), mRNA 
0   NM_057655.3  CG9160-RA, transcript variant A (mtacp1), mRNA 
0   NM_057654.3  CG9160-RB, transcript variant B (mtacp1), mRNA 
0   NM_080264.2  CG12767-RA (Dip3), mRNA 
0   NM_169223.2  CG31369-RA (PQBP-1), mRNA 
0   NM_141653.2  CG16789-RA (CG16789), mRNA 
0   NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   NM_134819.2  CG4270-RA, transcript variant A (CG4270), mRNA 
0   NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_164471.1  CG4270-RB, transcript variant B (CG4270), mRNA 
0   10  NM_143682.4  CG17461-RA (Kif3C), mRNA 
0   NM_079961.2  CG2872-RB, transcript variant B (AlstR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.