National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17239R-3 
 Symbol CG17239  Full Name CG17239 
 CG No CG17239  Old CG No CG17239 
 Synonyms SP138, CG17239 
 Accession No (Link to NCBI) NM_164469.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATTTTCCTGGCCTTCAGCGT 
 Primer Seq. 3'
aatctagaggtaccGACACTGATCCTGGTCCACAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATTTTCCTG GCCTTCAGCG TCACCGTGGT TTCCTCTAAT TGGATTCCGG AACGAATCGT 
0061 GGGAGGCGAC TTGATAACCA TTCTATCAGT TNCCCTGGCA GGCTTCCATT CTTAGGCGTG 
0121 GACGGTTTCA CTGCGGTGCA GCCNATCNTA CAGTGAAGAC ATCGTCATAA CGGCAGCCCA 
0181 CTGCCTCACC GACCGCGAGA CCGAGTTCCT CTCAGTGAGA GTCGGCTCAT CGTTCACATT 
0241 CTTCGGTGGT CAGGTGGTGA GGGTATCCAG GGTTCTGTTA CACGAGGAGT ACGACCAGTC 
0301 CTGGTCCAAC GACATAGCCG TGATGAGGCT TCAGTCCAAG CTCCGGCTGG GAAGTGCAGT 
0361 CAGTGTCATT CCCTTGGCCG ATACTCCTCC AGCCAGTGGA TCACCTGCCA CCGTTTCTGG 
0421 ATGGGGAGCC ATTGGTTATA AGAAGAATTA CCCCATATCC ATACTGTCCG CTTCGGTGGA 
0481 CATTGTGGAC CAGGATCAGT GTC 
 in silico PCR Fragment
0001 GATTTTCCTG GCCTTCAGCG TCACCGTGGT TTCCTCTAAT TGGATTCCGG AACGAATCGT 
0061 GGGAGGCGAC TTGATAACCA TTCTATCAGT T-CCCTGGCA GGCTTCCATT CTTAGGCTTG 
0121 GACGGTTTCA CTGCGGTGCA GCC-ATC-TA CAGTGAAGAC ATCGTCATAA CGGCAGCCCA 
0181 CTGCCTCACC GACCGCGAGA CCGAGTTCCT CTCAGTGAGA GTCGGCTCAT CGTTCACATT 
0241 CTTCGGTGGT CAGGTGGTGA GGGTATCCAG TGTTCTGTTA CACGAGGAAT ACGACCAGTC 
0301 CTGGTCCAAC GACATAGCCG TGATGAGGCT TCAGTCCAAG CTCCGGCTGG GAAGTGCAGT 
0361 CAGTGTCATT CCCTTGGCCG ATACTCCCCC GGCCAGTGGA TCACCTGCCA CCGTTTCTGG 
0421 ATGGGGAGCC ATTGGTTTTA AGAAGAATTA CCCCATGTCC ATACTGTCCG CTTCGGTGGA 
0481 CATTGTGGAC CAGGATCAGT GTC 
 Assemble Data

17239R-3.IR_full        1   ATTTTCCTGGCCTTCAGCGTCACCGTGGTTTCCTCTAATTGGATTCCGGAACGAATCGT 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17239R-3.in silico      1   ATTTTCCTGGCCTTCAGCGTCACCGTGGTTTCCTCTAATTGGATTCCGGAACGAATCGT 59


17239R-3.IR_full       61  GGGAGGCGACTTGATAACCATTCTATCAGTTNCCCTGGCAGGCTTCCATTCTTAGGCGTG 119
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||
17239R-3.in silico     61  GGGAGGCGACTTGATAACCATTCTATCAGTT-CCCTGGCAGGCTTCCATTCTTAGGCTTG 119


17239R-3.IR_full       121 GACGGTTTCACTGCGGTGCAGCCNATCNTACAGTGAAGACATCGTCATAACGGCAGCCCA 179
                           ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||
17239R-3.in silico     121 GACGGTTTCACTGCGGTGCAGCC-ATC-TACAGTGAAGACATCGTCATAACGGCAGCCCA 179


17239R-3.IR_full       181 CTGCCTCACCGACCGCGAGACCGAGTTCCTCTCAGTGAGAGTCGGCTCATCGTTCACATT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17239R-3.in silico     181 CTGCCTCACCGACCGCGAGACCGAGTTCCTCTCAGTGAGAGTCGGCTCATCGTTCACATT 239


17239R-3.IR_full       241 CTTCGGTGGTCAGGTGGTGAGGGTATCCAGGGTTCTGTTACACGAGGAGTACGACCAGTC 299
                           |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||
17239R-3.in silico     241 CTTCGGTGGTCAGGTGGTGAGGGTATCCAGTGTTCTGTTACACGAGGAATACGACCAGTC 299


17239R-3.IR_full       301 CTGGTCCAACGACATAGCCGTGATGAGGCTTCAGTCCAAGCTCCGGCTGGGAAGTGCAGT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17239R-3.in silico     301 CTGGTCCAACGACATAGCCGTGATGAGGCTTCAGTCCAAGCTCCGGCTGGGAAGTGCAGT 359


17239R-3.IR_full       361 CAGTGTCATTCCCTTGGCCGATACTCCTCCAGCCAGTGGATCACCTGCCACCGTTTCTGG 419
                           ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||
17239R-3.in silico     361 CAGTGTCATTCCCTTGGCCGATACTCCCCCGGCCAGTGGATCACCTGCCACCGTTTCTGG 419


17239R-3.IR_full       421 ATGGGGAGCCATTGGTTATAAGAAGAATTACCCCATATCCATACTGTCCGCTTCGGTGGA 479
                           ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||
17239R-3.in silico     421 ATGGGGAGCCATTGGTTTTAAGAAGAATTACCCCATGTCCATACTGTCCGCTTCGGTGGA 479


17239R-3.IR_full       481 CATTGTGGACCAGGATCAGTGTC 502
                           |||||||||||||||||||||||
17239R-3.in silico     481 CATTGTGGACCAGGATCAGTGTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164469.1  CG17239-RA (CG17239), mRNA 
0   NM_169839.1  CG17836-RA, transcript variant A (CG17836), mRNA 
0   NM_142504.2  CG17836-RB, transcript variant B (CG17836), mRNA 
0   NM_164472.1  CG17242-RA (CG17242), mRNA 
0   NM_169693.1  CG4261-RA (Hel89B), mRNA 
0   NM_140569.2  CG5841-RA (mib1), mRNA 
0   NM_206627.1  CG4068-RB, transcript variant B (CG4068), mRNA 
0   NM_140888.2  CG8743-RA (CG8743), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 
0   NM_169548.1  CG9351-RB, transcript variant B (flfl), mRNA 
0   NM_142047.1  CG9351-RA, transcript variant A (flfl), mRNA 
0   NM_169549.1  CG9351-RC, transcript variant C (flfl), mRNA 
0   NM_169207.1  CG7602-RB, transcript variant B (DNApol-iota), mRNA 
0   NM_141515.2  CG7602-RA, transcript variant A (DNApol-iota), mRNA 
0   NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   NM_142446.2  CG7142-RA (CG7142), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_057232.3  CG1934-RA (ImpE2), mRNA 
0   NM_138127.1  CG3650-RA (CG3650), mRNA 
0   NM_079011.2  CG6692-RC, transcript variant C (Cp1), mRNA 
0   NM_166027.1  CG6692-RB, transcript variant B (Cp1), mRNA 
0   NM_166026.1  CG6692-RA, transcript variant A (Cp1), mRNA 
0   NM_139833.1  CG8616-RA (CG8616), mRNA 
0   NM_170038.1  CG31151-RB, transcript variant B (wge), mRNA 
0   NM_170037.1  CG31151-RA, transcript variant A (wge), mRNA 
0   NM_001043281.1  CG31151-RC, transcript variant C (wge), mRNA 
0   NM_166031.1  CG8233-RA, transcript variant A (CG8233), mRNA 
0   NM_137083.2  CG8233-RB, transcript variant B (CG8233), mRNA 
0   NM_166032.1  CG8233-RC, transcript variant C (CG8233), mRNA 
0   NM_078671.3  CG7098-RA (dik), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.