National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17237R-1 
 Symbol CG17237  Full Name CG17237 
 CG No CG17237  Old CG No CG17237 
 Synonyms DmAAF51272, BcDNA:AT15471, CG17237 
 Accession No (Link to NCBI) NM_134822.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCATCAATCCGTCCATCATCGACCACACCGGACTGCAATCAGAAGCGGCGAGGCGACATG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACAGCTCCTCCTCCGAACCCAAAGCCAGAGAAAAGCCGCATCATGGAGATGCATGCGATT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     121 TTTCTGGGGCACGACACTCGCGGCGACAATAAGATATCCATCCGGCACCTGGGCCACTGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGCGTGCGATGGGCGCCACTCCCACGGAGGCGATGGTCAGCAAACATGTCCGCCAGTAC 240

                           |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     241 GAGGCCTCCACCATGCAGCGCATATGCT-TCGATGAGGTCATGGGCATCTACTCCAGTCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGCAAGCACGGCGGCATGTTGTCTCCCAAGAAAAAACAGATCGAGGCGGACCAGTTCGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATCCAGTCTAAGGGTCTTTGATACGGATAAGTCCGGTTGGATTCCCGCCATCAGACTCCG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCGCATTCTAACCAAGACCGGGGAGTGCATGGGCAGCATGGAAGTGGACGAGCTGCTCCA 480

17237R-1.IR_full       481 GGGTAGGATCAACAAATGACGG 502
                           |||||||||||||||| ||||| silico     481 GGGTAGGATCAACAAA-GACGG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134822.1  CG17237-RA (CG17237), mRNA 
0   NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_165458.1  CG7843-RC, transcript variant C (CG7843), mRNA 
0   NM_165459.1  CG7843-RD, transcript variant D (CG7843), mRNA 
0   NM_165460.1  CG7843-RB, transcript variant B (CG7843), mRNA 
0   NM_136359.2  CG7843-RA, transcript variant A (CG7843), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_078929.2  CG11205-RA, transcript variant A (phr), mRNA 
0   NM_165564.1  CG11205-RB, transcript variant B (phr), mRNA 
0   NM_136441.2  CG11140-RH, transcript variant H (Aldh-III), mRNA 
0   NM_206050.1  CG11140-RE, transcript variant E (Aldh-III), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_141676.2  CG12950-RA (CG12950), mRNA 
0   NM_165364.1  CG8676-RD, transcript variant D (Hr39), mRNA 
0   NM_134296.2  CG8676-RB, transcript variant B (Hr39), mRNA 
0   NM_057584.4  CG8676-RA, transcript variant A (Hr39), mRNA 
0   NM_057585.2  CG8676-RC, transcript variant C (Hr39), mRNA 
0   NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   NM_143483.1  CG7808-RC (RpS8), mRNA 
0   NM_137449.2  CG5661-RA (Sema-5c), mRNA 
0   NM_136827.2  CG7745-RA (CG7745), mRNA 
0   NM_142652.2  CG31200-RA (CG31200), mRNA 
0   NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
0   NM_166602.1  CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
0   NM_140320.1  CG10663-RA (CG10663), mRNA 
0   NM_166601.1  CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
0   NM_137946.2  CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.