National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17237R-1 
 Symbol CG17237  Full Name CG17237 
 CG No CG17237  Old CG No CG17237 
 Synonyms DmAAF51272, BcDNA:AT15471, CG17237 
 Accession No (Link to NCBI) NM_134822.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCATCAATCCGTCCATCATCG 
 Primer Seq. 3'
aatctagaggtaccCCGTCTTTGTTGATCCTACCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCATCAATCC GTCCATCATC GACCACACCG GACTGCAATC AGAAGCGGCG AGGCGACATG 
0061 ACAGCTCCTC CTCCGAACCC AAAGCCAGAG AAAAGCCGCA TCATGGAGAT GCATGCGATT 
0121 TTTCTGGGGC ACGACACTCG CGGCGACAAT AAGATATCCA TCCGGCACCT AGGCCACTGT 
0181 CTGCGTGCGA TGGGCGCCAC TCCCACGGAG GCGATGGTCA GCAAACATGT CCGCCAGTAC 
0241 GAGGCCTCTA CCATGCAGCG CATATGCTNT CGATGAGGTC ATGGGCATCT ACTCCAGTCT 
0301 TGGCAAGCAC GGCGGCATGT TGTCTCCCAA GAAAAAACAG ATCGAGGCGG ACCAGTTCGT 
0361 ATCCAGTCTA AGGGTCTTTG ATACGGATAA GTCCGGTTGG ATTCCCGCCA TCAGACTCCG 
0421 GCGCATTCTA ACCAAGACCG GGGAGTGCAT GGGCAGCATG GAAGTGGACG AGCTGCTCCA 
0481 GGGTAGGATC AACAAATGAC GG 
 in silico PCR Fragment
0001 TCATCAATCC GTCCATCATC GACCACACCG GACTGCAATC AGAAGCGGCG AGGCGACATG 
0061 ACAGCTCCTC CTCCGAACCC AAAGCCAGAG AAAAGCCGCA TCATGGAGAT GCATGCGATT 
0121 TTTCTGGGGC ACGACACTCG CGGCGACAAT AAGATATCCA TCCGGCACCT GGGCCACTGT 
0181 CTGCGTGCGA TGGGCGCCAC TCCCACGGAG GCGATGGTCA GCAAACATGT CCGCCAGTAC 
0241 GAGGCCTCCA CCATGCAGCG CATATGCT-T CGATGAGGTC ATGGGCATCT ACTCCAGTCT 
0301 TGGCAAGCAC GGCGGCATGT TGTCTCCCAA GAAAAAACAG ATCGAGGCGG ACCAGTTCGT 
0361 ATCCAGTCTA AGGGTCTTTG ATACGGATAA GTCCGGTTGG ATTCCCGCCA TCAGACTCCG 
0421 GCGCATTCTA ACCAAGACCG GGGAGTGCAT GGGCAGCATG GAAGTGGACG AGCTGCTCCA 
0481 GGGTAGGATC AACAAA-GAC GG 
 Assemble Data

17237R-1.IR_full       1   TCATCAATCCGTCCATCATCGACCACACCGGACTGCAATCAGAAGCGGCGAGGCGACATG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17237R-1.in silico     1   TCATCAATCCGTCCATCATCGACCACACCGGACTGCAATCAGAAGCGGCGAGGCGACATG 60


17237R-1.IR_full       61  ACAGCTCCTCCTCCGAACCCAAAGCCAGAGAAAAGCCGCATCATGGAGATGCATGCGATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17237R-1.in silico     61  ACAGCTCCTCCTCCGAACCCAAAGCCAGAGAAAAGCCGCATCATGGAGATGCATGCGATT 120


17237R-1.IR_full       121 TTTCTGGGGCACGACACTCGCGGCGACAATAAGATATCCATCCGGCACCTAGGCCACTGT 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
17237R-1.in silico     121 TTTCTGGGGCACGACACTCGCGGCGACAATAAGATATCCATCCGGCACCTGGGCCACTGT 180


17237R-1.IR_full       181 CTGCGTGCGATGGGCGCCACTCCCACGGAGGCGATGGTCAGCAAACATGTCCGCCAGTAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17237R-1.in silico     181 CTGCGTGCGATGGGCGCCACTCCCACGGAGGCGATGGTCAGCAAACATGTCCGCCAGTAC 240


17237R-1.IR_full       241 GAGGCCTCTACCATGCAGCGCATATGCTNTCGATGAGGTCATGGGCATCTACTCCAGTCT 300
                           |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||
17237R-1.in silico     241 GAGGCCTCCACCATGCAGCGCATATGCT-TCGATGAGGTCATGGGCATCTACTCCAGTCT 300


17237R-1.IR_full       301 TGGCAAGCACGGCGGCATGTTGTCTCCCAAGAAAAAACAGATCGAGGCGGACCAGTTCGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17237R-1.in silico     301 TGGCAAGCACGGCGGCATGTTGTCTCCCAAGAAAAAACAGATCGAGGCGGACCAGTTCGT 360


17237R-1.IR_full       361 ATCCAGTCTAAGGGTCTTTGATACGGATAAGTCCGGTTGGATTCCCGCCATCAGACTCCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17237R-1.in silico     361 ATCCAGTCTAAGGGTCTTTGATACGGATAAGTCCGGTTGGATTCCCGCCATCAGACTCCG 420


17237R-1.IR_full       421 GCGCATTCTAACCAAGACCGGGGAGTGCATGGGCAGCATGGAAGTGGACGAGCTGCTCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17237R-1.in silico     421 GCGCATTCTAACCAAGACCGGGGAGTGCATGGGCAGCATGGAAGTGGACGAGCTGCTCCA 480


17237R-1.IR_full       481 GGGTAGGATCAACAAATGACGG 502
                           |||||||||||||||| |||||
17237R-1.in silico     481 GGGTAGGATCAACAAA-GACGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134822.1  CG17237-RA (CG17237), mRNA 
0   NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_165458.1  CG7843-RC, transcript variant C (CG7843), mRNA 
0   NM_165459.1  CG7843-RD, transcript variant D (CG7843), mRNA 
0   NM_165460.1  CG7843-RB, transcript variant B (CG7843), mRNA 
0   NM_136359.2  CG7843-RA, transcript variant A (CG7843), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_078929.2  CG11205-RA, transcript variant A (phr), mRNA 
0   NM_165564.1  CG11205-RB, transcript variant B (phr), mRNA 
0   NM_136441.2  CG11140-RH, transcript variant H (Aldh-III), mRNA 
0   NM_206050.1  CG11140-RE, transcript variant E (Aldh-III), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_141676.2  CG12950-RA (CG12950), mRNA 
0   NM_165364.1  CG8676-RD, transcript variant D (Hr39), mRNA 
0   NM_134296.2  CG8676-RB, transcript variant B (Hr39), mRNA 
0   NM_057584.4  CG8676-RA, transcript variant A (Hr39), mRNA 
0   NM_057585.2  CG8676-RC, transcript variant C (Hr39), mRNA 
0   NM_168881.1  CG32434-RB, transcript variant B (siz), mRNA 
0   NM_143483.1  CG7808-RC (RpS8), mRNA 
0   NM_137449.2  CG5661-RA (Sema-5c), mRNA 
0   NM_136827.2  CG7745-RA (CG7745), mRNA 
0   NM_142652.2  CG31200-RA (CG31200), mRNA 
0   NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
0   NM_166602.1  CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
0   NM_140320.1  CG10663-RA (CG10663), mRNA 
0   NM_166601.1  CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
0   NM_137946.2  CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.