National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17233R-3 
 Symbol CG17233  Full Name CG17233 
 CG No CG17233  Old CG No CG17233 
 Synonyms CG6918, CG17233 
 Accession No (Link to NCBI) NM_168836.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGATCCCAATTCCAGTCCCTGGTCATACGCCTACAACCGCATCGTGCCCGCCAGTGCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAAGCTCCGGCGGAACAGCAGAGGACTTCCAGCATCCACACCTGGCCACCATTACGGCA 120

                           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     121 GCAAGCATCGCCAGCTTTAATGCGGCGGCCGCCAGTGGTGGCAGCTTTGTGCCTCCGTCA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     181 CCGATTGGCAGCTACAACCCAGTATTCCAGCAGATCTACCACCATGCGGCGGCGGCCAGT 240

                           ||||||||||||||||||||| ||||||||||||| ||||| |||| ||||| ||| ||| silico     241 GTCCAGCCTAAGCCCGCCCAC-TATGCCTCGTCAGCGGTGA-GCACGCCGCA-CCGCCAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGCAGCTGCCCAGTTCGCTGGACAAGCAGCTCAGTTCGTTCCAGAACCAGGCGGCCGTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCGGCGGCAGCGGCTGCTGTAGTCAACAATGTTGCCTCGAACTATTACGGGGAGAACTCC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCGTCGAGTGGAGCCTCACCATCGCCCACAACGGTGGCCCTGACGTCGACGTCGCTGACC 480

17233R-3.IR_full       481 TGGAACACGCCGAACATGATATC 503
                           ||||||||||||||||||||||| silico     481 TGGAACACGCCGAACATGATATC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
100   482  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
57.67   278  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0   20  NM_206303.1  CG6964-RD, transcript variant D (Gug), mRNA 
0   20  NM_176300.1  CG6964-RC, transcript variant C (Gug), mRNA 
0   20  NM_145106.1  CG6964-RA, transcript variant A (Gug), mRNA 
0   20  NM_079249.2  CG6964-RB, transcript variant B (Gug), mRNA 
0   NM_141780.2  CG4674-RA (CG4674), mRNA 
0   NM_132538.1  CG15737-RA (CG15737), mRNA 
0   NM_206201.1  CG6044-RC, transcript variant C (CG6044), mRNA 
0   NM_166531.1  CG6044-RB, transcript variant B (CG6044), mRNA 
0   NM_137824.1  CG6044-RA, transcript variant A (CG6044), mRNA 
0   NM_164496.1  CG2903-RC, transcript variant C (Hrs), mRNA 
0   NM_080360.3  CG2903-RB, transcript variant B (Hrs), mRNA 
0   NM_164497.1  CG2903-RA, transcript variant A (Hrs), mRNA 
0   11  NM_079938.3  CG2102-RA (cas), mRNA 
0   25  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   25  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_206092.1  CG7736-RD, transcript variant D (Syx6), mRNA 
0   NM_206094.1  CG7736-RE, transcript variant E (Syx6), mRNA 
0   NM_206093.1  CG7736-RB, transcript variant B (Syx6), mRNA 
0   NM_167340.1  CG32648-RA (Pde9), mRNA 
0   NM_136273.2  CG1512-RB, transcript variant B (cul-2), mRNA 
0   NM_165390.1  CG1512-RA, transcript variant A (cul-2), mRNA 
0   12  NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_130511.1  CG14632-RB, transcript variant B (CG14632), mRNA 
0   NM_166864.1  CG14632-RA, transcript variant A (CG14632), mRNA 
0   NM_141240.1  CG14656-RA (CG14656), mRNA 
0   NM_132465.2  CG1397-RA (CG1397), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.