National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17233R-1 
 Symbol CG17233  Full Name CG17233 
 CG No CG17233  Old CG No CG17233 
 Synonyms CG6918, CG17233 
 Accession No (Link to NCBI) NM_168836.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGATCCCAATTCCAGTCCC 
 Primer Seq. 3'
aatctagaggtaccGATATCATGTTCGGCGTGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGATCCCA ATTCCAGTCC CTGGTCATAC GCCTACAACC GCATCGTGCC CGCCAGTGCC 
0061 GGAAGCTCCG GCGGAACAGC AGAGGACTTC CAGCATCCAC ACCTGGCCAC CATTACGGCA 
0121 GCAAGCATCG CCAGCTTTAA TGCGGCGGCC GCCAGTGGTG GNAGCTTTGT GCCTCCGTCA 
0181 CCGATTGGCA GCTACAACCC AGTATTCCAG CAGATCTACC ACCATGCGGc CGCGGCCAGT 
0241 GTCCAGCCTA AGCCCGCCCA CNTATGCCTC GTCAGNGGTG ANGCACNCCG CANCCGNCAG 
0301 CTGCAGCTGC CCAGTTCGCT GGACAAGCAG CTCAGTTCGT TCCAGAACCA GGCGGcCGTG 
0361 TCGGCGGCAG CGGCTGCTGT AGTCAACAAT GTTGCCTCGA ACTATTACGG GGAGAACTCC 
0421 TCGTCGAGTG GAGCCTCACC ATCGCCCACA ACGGTGGCCC TGACGTCGAC GTCGCTGACC 
0481 TGGAACACGC CGAACATGAT ATC 
 in silico PCR Fragment
0001 ATGGATCCCA ATTCCAGTCC CTGGTCATAC GCCTACAACC GCATCGTGCC CGCCAGTGCC 
0061 GGAAGCTCCG GCGGAACAGC AGAGGACTTC CAGCATCCAC ACCTGGCCAC CATTACGGCA 
0121 GCAAGCATCG CCAGCTTTAA TGCGGCGGCC GCCAGTGGTG GCAGCTTTGT GCCTCCGTCA 
0181 CCGATTGGCA GCTACAACCC AGTATTCCAG CAGATCTACC ACCATGCGGC GGCGGCCAGT 
0241 GTCCAGCCTA AGCCCGCCCA C-TATGCCTC GTCAGCGGTG A-GCACGCCG CA-CCGCCAG 
0301 CTGCAGCTGC CCAGTTCGCT GGACAAGCAG CTCAGTTCGT TCCAGAACCA GGCGGCCGTG 
0361 TCGGCGGCAG CGGCTGCTGT AGTCAACAAT GTTGCCTCGA ACTATTACGG GGAGAACTCC 
0421 TCGTCGAGTG GAGCCTCACC ATCGCCCACA ACGGTGGCCC TGACGTCGAC GTCGCTGACC 
0481 TGGAACACGC CGAACATGAT ATC 
 Assemble Data

17233R-1.IR_full       1   ATGGATCCCAATTCCAGTCCCTGGTCATACGCCTACAACCGCATCGTGCCCGCCAGTGCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17233R-1.in silico     1   ATGGATCCCAATTCCAGTCCCTGGTCATACGCCTACAACCGCATCGTGCCCGCCAGTGCC 60


17233R-1.IR_full       61  GGAAGCTCCGGCGGAACAGCAGAGGACTTCCAGCATCCACACCTGGCCACCATTACGGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17233R-1.in silico     61  GGAAGCTCCGGCGGAACAGCAGAGGACTTCCAGCATCCACACCTGGCCACCATTACGGCA 120


17233R-1.IR_full       121 GCAAGCATCGCCAGCTTTAATGCGGCGGCCGCCAGTGGTGGNAGCTTTGTGCCTCCGTCA 180
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
17233R-1.in silico     121 GCAAGCATCGCCAGCTTTAATGCGGCGGCCGCCAGTGGTGGCAGCTTTGTGCCTCCGTCA 180


17233R-1.IR_full       181 CCGATTGGCAGCTACAACCCAGTATTCCAGCAGATCTACCACCATGCGGCCGCGGCCAGT 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
17233R-1.in silico     181 CCGATTGGCAGCTACAACCCAGTATTCCAGCAGATCTACCACCATGCGGCGGCGGCCAGT 240


17233R-1.IR_full       241 GTCCAGCCTAAGCCCGCCCACNTATGCCTCGTCAGNGGTGANGCACNCCGCANCCGNCAG 300
                           ||||||||||||||||||||| ||||||||||||| ||||| |||| ||||| ||| |||
17233R-1.in silico     241 GTCCAGCCTAAGCCCGCCCAC-TATGCCTCGTCAGCGGTGA-GCACGCCGCA-CCGCCAG 300


17233R-1.IR_full       301 CTGCAGCTGCCCAGTTCGCTGGACAAGCAGCTCAGTTCGTTCCAGAACCAGGCGGCCGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17233R-1.in silico     301 CTGCAGCTGCCCAGTTCGCTGGACAAGCAGCTCAGTTCGTTCCAGAACCAGGCGGCCGTG 360


17233R-1.IR_full       361 TCGGCGGCAGCGGCTGCTGTAGTCAACAATGTTGCCTCGAACTATTACGGGGAGAACTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17233R-1.in silico     361 TCGGCGGCAGCGGCTGCTGTAGTCAACAATGTTGCCTCGAACTATTACGGGGAGAACTCC 420


17233R-1.IR_full       421 TCGTCGAGTGGAGCCTCACCATCGCCCACAACGGTGGCCCTGACGTCGACGTCGCTGACC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17233R-1.in silico     421 TCGTCGAGTGGAGCCTCACCATCGCCCACAACGGTGGCCCTGACGTCGACGTCGCTGACC 480


17233R-1.IR_full       481 TGGAACACGCCGAACATGATATC 503
                           |||||||||||||||||||||||
17233R-1.in silico     481 TGGAACACGCCGAACATGATATC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
100   482  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
57.67   278  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0   20  NM_206303.1  CG6964-RD, transcript variant D (Gug), mRNA 
0   20  NM_176300.1  CG6964-RC, transcript variant C (Gug), mRNA 
0   20  NM_145106.1  CG6964-RA, transcript variant A (Gug), mRNA 
0   20  NM_079249.2  CG6964-RB, transcript variant B (Gug), mRNA 
0   NM_141780.2  CG4674-RA (CG4674), mRNA 
0   NM_132538.1  CG15737-RA (CG15737), mRNA 
0   NM_206201.1  CG6044-RC, transcript variant C (CG6044), mRNA 
0   NM_166531.1  CG6044-RB, transcript variant B (CG6044), mRNA 
0   NM_137824.1  CG6044-RA, transcript variant A (CG6044), mRNA 
0   NM_164496.1  CG2903-RC, transcript variant C (Hrs), mRNA 
0   NM_080360.3  CG2903-RB, transcript variant B (Hrs), mRNA 
0   NM_164497.1  CG2903-RA, transcript variant A (Hrs), mRNA 
0   11  NM_079938.3  CG2102-RA (cas), mRNA 
0   25  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   25  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_206092.1  CG7736-RD, transcript variant D (Syx6), mRNA 
0   NM_206094.1  CG7736-RE, transcript variant E (Syx6), mRNA 
0   NM_206093.1  CG7736-RB, transcript variant B (Syx6), mRNA 
0   NM_167340.1  CG32648-RA (Pde9), mRNA 
0   NM_136273.2  CG1512-RB, transcript variant B (cul-2), mRNA 
0   NM_165390.1  CG1512-RA, transcript variant A (cul-2), mRNA 
0   12  NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_130511.1  CG14632-RB, transcript variant B (CG14632), mRNA 
0   NM_166864.1  CG14632-RA, transcript variant A (CG14632), mRNA 
0   NM_141240.1  CG14656-RA (CG14656), mRNA 
0   NM_132465.2  CG1397-RA (CG1397), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.