National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1722R-1 
 Symbol CG1722  Full Name CG1722 
 CG No CG1722  Old CG No CG1722 
 Synonyms CG1722 
 Accession No (Link to NCBI) NM_134599.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGCGGCTACAAAACCGCTTA 
 Primer Seq. 3'
aatctagaggtaccCTTTACGCCGAGATTGCAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGCGGCTAC AAAACCGCTT AGCACAAAGA AGCTACAGTC CAAAGTCAAA AGTGTCGGTA 
0061 AGACCAAGCC GAAAATGCAG CAGAAATCCG TAAAGCAACC GCTCAAGAAA CCCATGAGAC 
0121 GATCTCCGCT GATGCGAGCC GCCCTCCAGC CCACCATTTT GGGCTTGGCC AAGGAAAAGC 
0181 CGGTGAAAAA GTCGCGGGTG ACCTTCAAGA AGTCACATCG TCGGCCGCTG GACGCCATGC 
0241 AATCCCTTGG GATGTCCCGC AGGACCAGAC TCATAGACGC CAGTCCCCAG AGAAAGGCCA 
0301 AGGGTACTTC GGTACTGTTC CTGGGTAAGG ATTCAAGGAC CACCAAGATG CCCAAGAAAA 
0361 TGAAGCCCTC AAGCGAAAAG CCAGCAAGCG AAAAAAATCA GTTACCCCGG TTAAAAAGAC 
0421 GGATGGAATT CCGAGTAATG ACGAAAGCCG AGACTAGGGC TACCGACGGC GTGAACTTCT 
0481 TCTGCAATCT CGGCGTAAAG  
 in silico PCR Fragment
0001 AAGCGGCTAC AAAACCGCTT AGCACAAAGA AGCTACAGTC CAAAGTCAAA AGTGTCGGTA 
0061 AGACCAAGCC GAAAATGCAG CAGAAATCCG TAAAGCAACC GCTCAAGAAA CCCATGAGAC 
0121 GATCTCCGCT GATGCGAGCC GCCCTCCAGC CCACCATTTT GGGCTTGGCC AAGGAAAAGC 
0181 CGGTGAAAAA GTCGCGGGTG ACCTTCAAGA AGTCACATCG TCGGCCGCTG GACGCCATGC 
0241 AATCCCTTGG GATGTCCCGC AGGACCAGAC TCATAGACGC CAGTCCCCAG AGAAAGGCCA 
0301 AGGGTACTTC GGTACTGTTC CTGGGTAAGG ATTCAAGGAC CACCAAGATG CCCAAGAAAA 
0361 TGAAGCCCTC AAGCGAAAAG CCTGCAAGCG AAAAAAATCA GTTACCCCGG TTAAAAAGAC 
0421 GGATGGAATT CCGAGTAATG ACGAAAGCCG AGACTAGGGC TACCGACGGC GTGAACTTCT 
0481 TCTGCAATCT CGGCGTAAAG  
 Assemble Data

1722R-1.IR_full       1   AAGCGGCTACAAAACCGCTTAGCACAAAGAAGCTACAGTCCAAAGTCAAAAGTGTCGGTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     1   AAGCGGCTACAAAACCGCTTAGCACAAAGAAGCTACAGTCCAAAGTCAAAAGTGTCGGTA 60


1722R-1.IR_full       61  AGACCAAGCCGAAAATGCAGCAGAAATCCGTAAAGCAACCGCTCAAGAAACCCATGAGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     61  AGACCAAGCCGAAAATGCAGCAGAAATCCGTAAAGCAACCGCTCAAGAAACCCATGAGAC 120


1722R-1.IR_full       121 GATCTCCGCTGATGCGAGCCGCCCTCCAGCCCACCATTTTGGGCTTGGCCAAGGAAAAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     121 GATCTCCGCTGATGCGAGCCGCCCTCCAGCCCACCATTTTGGGCTTGGCCAAGGAAAAGC 180


1722R-1.IR_full       181 CGGTGAAAAAGTCGCGGGTGACCTTCAAGAAGTCACATCGTCGGCCGCTGGACGCCATGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     181 CGGTGAAAAAGTCGCGGGTGACCTTCAAGAAGTCACATCGTCGGCCGCTGGACGCCATGC 240


1722R-1.IR_full       241 AATCCCTTGGGATGTCCCGCAGGACCAGACTCATAGACGCCAGTCCCCAGAGAAAGGCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     241 AATCCCTTGGGATGTCCCGCAGGACCAGACTCATAGACGCCAGTCCCCAGAGAAAGGCCA 300


1722R-1.IR_full       301 AGGGTACTTCGGTACTGTTCCTGGGTAAGGATTCAAGGACCACCAAGATGCCCAAGAAAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     301 AGGGTACTTCGGTACTGTTCCTGGGTAAGGATTCAAGGACCACCAAGATGCCCAAGAAAA 360


1722R-1.IR_full       361 TGAAGCCCTCAAGCGAAAAGCCAGCAAGCGAAAAAAATCAGTTACCCCGGTTAAAAAGAC 420
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1722R-1.in silico     361 TGAAGCCCTCAAGCGAAAAGCCTGCAAGCGAAAAAAATCAGTTACCCCGGTTAAAAAGAC 420


1722R-1.IR_full       421 GGATGGAATTCCGAGTAATGACGAAAGCCGAGACTAGGGCTACCGACGGCGTGAACTTCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1722R-1.in silico     421 GGATGGAATTCCGAGTAATGACGAAAGCCGAGACTAGGGCTACCGACGGCGTGAACTTCT 480


1722R-1.IR_full       481 TCTGCAATCTCGGCGTAAAG 500
                          ||||||||||||||||||||
1722R-1.in silico     481 TCTGCAATCTCGGCGTAAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134599.1  CG1722-RA (CG1722), mRNA 
0   NM_139423.1  CG5690-RA (CG5690), mRNA 
0   NM_058116.3  CG10047-RA (SytIV), mRNA 
0   NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   NR_002032.1  CG1695-RA, transcript variant A (CG1695), mRNA, miscRNA 
0   NM_137594.2  CG11018-RA (CG11018), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 
0   NM_137513.2  CG15086-RA, transcript variant A (CG15086), mRNA 
0   NM_176227.1  CG15086-RD, transcript variant D (CG15086), mRNA 
0   NM_176226.1  CG15086-RC, transcript variant C (CG15086), mRNA 
0   NM_141940.1  CG5245-RA (CG5245), mRNA 
0   NM_165625.1  CG8739-RA, transcript variant A (cmp44E), mRNA 
0   NM_165624.1  CG8739-RB, transcript variant B (cmp44E), mRNA 
0   NM_001014513.1  CG8739-RC, transcript variant C (cmp44E), mRNA 
0   NM_143783.2  CG5824-RA (l(3)07882), mRNA 
0   NM_170213.2  CG31102-RA (CG31102), mRNA 
0   101  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_079990.2  CG15667-RA, transcript variant A (Sara), mRNA 
0   NM_166451.1  CG15667-RB, transcript variant B (Sara), mRNA 
0   NM_137209.2  CG8214-RA (CG8214), mRNA 
0   NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_132050.1  CG3011-RA (CG3011), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_143244.2  CG6403-RA (CG6403), mRNA 
0   NM_137988.2  CG5543-RA (CG5543), mRNA 
0   NM_140825.2  CG18135-RA, transcript variant A (CG18135), mRNA 
0   NM_176346.1  CG18135-RB, transcript variant B (CG18135), mRNA 
0   NM_176347.1  CG18135-RC, transcript variant C (CG18135), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.