National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1718R-3 
 Symbol CG1718  Full Name CG1718 
 CG No CG1718  Old CG No CG1718 
 Synonyms CG1718 
 Accession No (Link to NCBI) NM_134601.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat Cell Biol (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCAAAGGTCACAAACTGGG 
 Primer Seq. 3'
aatctagaggtaccTGCTATGGCAATCGTCGCCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCAAAGGT CACAAACTGG GATAAGTTTG TGCTGCTTTT GTGGAAGAAC TGGACCCTCC 
0061 AATGGAACCA CAAGTGGCAG ATGGTTATAG AGCTGGTGCT GCCAGCGATA TTCTCCCTGC 
0121 TCCTCGTTCT AGTCCGCACC TTGGTGGATA CGGAGCAAAA AGGAGTCCGG TATTATAATG 
0181 AGCAGAACTT AACAGACCTC AATCTGCTGC AGAAGAATGG CGGCTTTTCA AAATTTGAGT 
0241 TCATCCTGTG CTACTCGCCC GTCAATCCCG TGTTGAAGAA ACTGGTAGAA GAGGCGTGGC 
0301 AGAGCCTTGG TAAGAACAAA ATCTGTGAGT CTGGAAAATG CCACCCAACT GGAGTTGGAT 
0361 ACGGTCAGTA AGAACGCCTT TGCTGGCGTT CAGTTCGACG ATGCCTGGGC GAATCTTACG 
0421 GAGAATGACC CTCTACCCAA TGACTTTCAT TTCGCACTGA GATTCCCAGC GGAGCTGCGA 
0481 ACGGCGACGA TTGCCATAGC A 
 in silico PCR Fragment
0001 TGGCAAAGGT CACAAACTGG GATAAGTTTG TGCTGCTTTT GTGGAAGAAC TGGACCCTCC 
0061 AATGGAACCA CAAGTGGCAG ATGGTTATAG AGCTGGTGCT GCCAGCGATA TTCTCCCTGC 
0121 TCCTCGTTCT AGTCCGCACC TTGGTGGATA CGGAGCAAAA AGGAGTCCGG TATTATAATG 
0181 AGCAGAACTT AACAGACCTC AATCTGCTGC AGAAGAATGG CGGCTTTTCA AAATTTGAGT 
0241 TCATCCTGTG CTACTCGCCC GTCAATCCCG TGTTGAAGAA ACTGGTAGAA GAGGCGTGGC 
0301 AGAGCCTTGG TAAGAACAAA ATCTGTGAGT C-GGAAAATG CCACCCAACT GGAGTTGGAT 
0361 ACGGTCAGTA AGAACGCCTT TGCTGGCGTT CAGTTCGACG ATGCCTGGGC GAATCTTACG 
0421 GAGAATGACC CTCTACCCAA TGACTTTCAT TTCGCACTGA GATTCCCAGC GGAGCTGCGA 
0481 ACGGCGACGA TTGCCATAGC A 
 Assemble Data

1718R-3.IR_full       1   TGGCAAAGGTCACAAACTGGGATAAGTTTGTGCTGCTTTTGTGGAAGAACTGGACCCTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     1   TGGCAAAGGTCACAAACTGGGATAAGTTTGTGCTGCTTTTGTGGAAGAACTGGACCCTCC 60


1718R-3.IR_full       61  AATGGAACCACAAGTGGCAGATGGTTATAGAGCTGGTGCTGCCAGCGATATTCTCCCTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     61  AATGGAACCACAAGTGGCAGATGGTTATAGAGCTGGTGCTGCCAGCGATATTCTCCCTGC 120


1718R-3.IR_full       121 TCCTCGTTCTAGTCCGCACCTTGGTGGATACGGAGCAAAAAGGAGTCCGGTATTATAATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     121 TCCTCGTTCTAGTCCGCACCTTGGTGGATACGGAGCAAAAAGGAGTCCGGTATTATAATG 180


1718R-3.IR_full       181 AGCAGAACTTAACAGACCTCAATCTGCTGCAGAAGAATGGCGGCTTTTCAAAATTTGAGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     181 AGCAGAACTTAACAGACCTCAATCTGCTGCAGAAGAATGGCGGCTTTTCAAAATTTGAGT 240


1718R-3.IR_full       241 TCATCCTGTGCTACTCGCCCGTCAATCCCGTGTTGAAGAAACTGGTAGAAGAGGCGTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     241 TCATCCTGTGCTACTCGCCCGTCAATCCCGTGTTGAAGAAACTGGTAGAAGAGGCGTGGC 300


1718R-3.IR_full       301 AGAGCCTTGGTAAGAACAAAATCTGTGAGTCTGGAAAATGCCACCCAACTGGAGTTGGAT 360
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
1718R-3.in silico     301 AGAGCCTTGGTAAGAACAAAATCTGTGAGTC-GGAAAATGCCACCCAACTGGAGTTGGAT 360


1718R-3.IR_full       361 ACGGTCAGTAAGAACGCCTTTGCTGGCGTTCAGTTCGACGATGCCTGGGCGAATCTTACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     361 ACGGTCAGTAAGAACGCCTTTGCTGGCGTTCAGTTCGACGATGCCTGGGCGAATCTTACG 420


1718R-3.IR_full       421 GAGAATGACCCTCTACCCAATGACTTTCATTTCGCACTGAGATTCCCAGCGGAGCTGCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1718R-3.in silico     421 GAGAATGACCCTCTACCCAATGACTTTCATTTCGCACTGAGATTCCCAGCGGAGCTGCGA 480


1718R-3.IR_full       481 ACGGCGACGATTGCCATAGCA 501
                          |||||||||||||||||||||
1718R-3.in silico     481 ACGGCGACGATTGCCATAGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_137189.2  CG8166-RA (unc-5), mRNA 
0   NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 
0   NM_142753.2  CG5740-RB, transcript variant B (CG5740), mRNA 
0   NM_135136.1  CG13996-RA (CG13996), mRNA 
0   NM_141569.3  CG8202-RA (CG8202), mRNA 
0   NM_079354.3  CG17871-RB (Or71a), mRNA 
0   NM_140631.1  CG4729-RA, transcript variant A (CG4729), mRNA 
0   NM_168662.1  CG4729-RC, transcript variant C (CG4729), mRNA 
0   NM_168661.1  CG4729-RB, transcript variant B (CG4729), mRNA 
0   NM_001038963.1  CG14372-RB (CG14372), mRNA 
0   NM_167991.1  CG15812-RB, transcript variant B (pfk), mRNA 
0   NM_001014463.1  CG3234-RE, transcript variant E (tim), mRNA 
0   NM_001038783.1  CG3234-RF, transcript variant F (tim), mRNA 
0   NM_078744.3  CG3234-RA, transcript variant A (tim), mRNA 
0   NM_164541.3  CG3234-RC, transcript variant C (tim), mRNA 
0   NM_164540.2  CG3234-RD, transcript variant D (tim), mRNA 
0   NM_164542.3  CG3234-RB, transcript variant B (tim), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_206710.1  CG1372-RB, transcript variant B (yl), mRNA 
0   NM_078596.2  CG1372-RA, transcript variant A (yl), mRNA 
0   NM_135933.2  CG4891-RA (CG4891), mRNA 
0   NM_079901.2  CG10811-RA (eIF-4G), mRNA 
0   16  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.