National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17149R-1 
 Symbol Hdm  Full Name Histone demethylase 
 CG No CG17149  Old CG No CG17149 
 Synonyms Hdm, CG17149, Dmel?LSD1, Dmel/HDM, Dmel/LSD1 
 Accession No (Link to NCBI) NM_140937.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Eliazer S, Shalaby NA, Buszczak M.
Loss of lysine-specific demethylase 1 nonautonomously causes stem cell tumors in the Drosophila ovary.
Proc. Natl. Acad. Sci. U.S.A. (2011) 108(17) 7064-9 [ PubMed ID = 21482791 ] [ RRC reference ]

Eliazer S, Palacios V, Wang Z, Kollipara RK, Kittler R, Buszczak M.
Lsd1 restricts the number of germline stem cells by regulating multiple targets in escort cells.
PLoS Genet. (2014) 10(3) e1004200 [ PubMed ID = 24625679 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCCAGTTCGGAGGCAGTAGC 
 Primer Seq. 3'
aatctagaggtaccGGCAGGCGAGATTGGAAGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCCAGTTCG GAGGCAGTAG CTCCAAGATG ACCGAGCCAA TTGAGTATGT GACGCTAATT 
0061 AGCGACGATT CCGATGGTGA GCCCACGCCC AAAAGAAACG TCAATCACCC GCCGTCGGCA 
0121 TTGTCAGCAC CCAATCCTGG TCAGAAACAA AAGCACCCGG ATGAGGACTC AAATGACNGC 
0181 ACCTGCCACC AGCGATGAGC GACGCACAAG TAGGCGCAAT CGGCCAAAAG TGGATTATAG 
0241 TAACAGGCCT AGTGGAAGTG GAGACACCGC CTCCAATGAC AAGTCAGGAT CGGCATCCAT 
0301 GGGACCTAAC AACCAGCAAG CAGANNGTCG CAACCAAAGC CAAACCCGCA AGTCAGAAGC 
0361 CAATGCTACC TCCTCCTCCG TGTCCGGACC CAGTGCCGGA AATTCCAGAC CGTCCCAGAA 
0421 CGGAGATTCC AAGGAcCGGG ATGCCgGCAC GCCCACGGTT TTGTCTGGCC AAGAGGGCGC 
0481 CGTCTTCCAA TCTCGcCTNC C 
 in silico PCR Fragment
0001 ACCCAGTTCG GAGGCAGTAG CTCCAAGATG ACCGAGCCAA TTGAGTATGT GACGCTAATT 
0061 AGCGACGATT CCGATGGTGA GCCCACGCCC AAAAGAAACG TCAATCACCC GCCGTCGGCA 
0121 TTGTCAGCAC CCAATCCTGG TCAGAAACAA AAGCACCCGG ATGAGGACTC AAATGAC-GC 
0181 ACCTGCCACC AGCGATGAGC GACGCACAAG TAGGCGCAAT CGGCCAAAAG TGGATTATAG 
0241 TAACAGGCCT AGTGGAAGTG GAGACACCGC CTCCAATGAC AAGTCAGGAT CGGCATCCAT 
0301 GGGACCTAAC AACCAGCAAG CAGAGCGTCG CAGCCAAAGC CAAACCCGCA AGTCAGAAGC 
0361 CAATGCTACC TCCTCCTCCG TGTCCGGACC CAGTGCCGGA AATTCCAGAC CGTCCCAGAA 
0421 CGGAGATTCC AAGGACCGGG ATGCCGGCAC GCCCACGGTT TTGTCTGGCC AAGAGGGCGC 
0481 CGTCTTCCAA TCTCGCCTGC C 
 Assemble Data

17149R-1.IR_full       1   ACCCAGTTCGGAGGCAGTAGCTCCAAGATGACCGAGCCAATTGAGTATGTGACGCTAATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17149R-1.in silico     1   ACCCAGTTCGGAGGCAGTAGCTCCAAGATGACCGAGCCAATTGAGTATGTGACGCTAATT 60


17149R-1.IR_full       61  AGCGACGATTCCGATGGTGAGCCCACGCCCAAAAGAAACGTCAATCACCCGCCGTCGGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17149R-1.in silico     61  AGCGACGATTCCGATGGTGAGCCCACGCCCAAAAGAAACGTCAATCACCCGCCGTCGGCA 120


17149R-1.IR_full       121 TTGTCAGCACCCAATCCTGGTCAGAAACAAAAGCACCCGGATGAGGACTCAAATGACNGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
17149R-1.in silico     121 TTGTCAGCACCCAATCCTGGTCAGAAACAAAAGCACCCGGATGAGGACTCAAATGAC-GC 180


17149R-1.IR_full       181 ACCTGCCACCAGCGATGAGCGACGCACAAGTAGGCGCAATCGGCCAAAAGTGGATTATAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17149R-1.in silico     181 ACCTGCCACCAGCGATGAGCGACGCACAAGTAGGCGCAATCGGCCAAAAGTGGATTATAG 240


17149R-1.IR_full       241 TAACAGGCCTAGTGGAAGTGGAGACACCGCCTCCAATGACAAGTCAGGATCGGCATCCAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17149R-1.in silico     241 TAACAGGCCTAGTGGAAGTGGAGACACCGCCTCCAATGACAAGTCAGGATCGGCATCCAT 300


17149R-1.IR_full       301 GGGACCTAACAACCAGCAAGCAGANNGTCGCAACCAAAGCCAAACCCGCAAGTCAGAAGC 360
                           ||||||||||||||||||||||||  |||||| |||||||||||||||||||||||||||
17149R-1.in silico     301 GGGACCTAACAACCAGCAAGCAGAGCGTCGCAGCCAAAGCCAAACCCGCAAGTCAGAAGC 360


17149R-1.IR_full       361 CAATGCTACCTCCTCCTCCGTGTCCGGACCCAGTGCCGGAAATTCCAGACCGTCCCAGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17149R-1.in silico     361 CAATGCTACCTCCTCCTCCGTGTCCGGACCCAGTGCCGGAAATTCCAGACCGTCCCAGAA 420


17149R-1.IR_full       421 CGGAGATTCCAAGGACCGGGATGCCGGCACGCCCACGGTTTTGTCTGGCCAAGAGGGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17149R-1.in silico     421 CGGAGATTCCAAGGACCGGGATGCCGGCACGCCCACGGTTTTGTCTGGCCAAGAGGGCGC 480


17149R-1.IR_full       481 CGTCTTCCAATCTCGCCTNCC 501
                           |||||||||||||||||| ||
17149R-1.in silico     481 CGTCTTCCAATCTCGCCTGCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140937.2  CG17149-RA, transcript variant A (CG17149), mRNA 
100   482  NM_168835.1  CG17149-RB, transcript variant B (CG17149), mRNA 
0   NM_132073.1  CG14445-RA (CG14445), mRNA 
0   NM_140383.1  CG10191-RA (CG10191), mRNA 
0   NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
0   NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
0   NM_169375.1  CG31299-RB, transcript variant B (nocturnin), mRNA 
0   NM_169374.1  CG31299-RA, transcript variant A (nocturnin), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_135967.1  CG13272-RA (CG13272), mRNA 
0   NM_135226.2  CG11221-RA (CG11221), mRNA 
0   NM_130482.2  CG12470-RA (CG12470), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   NM_141495.2  CG2791-RA (CG2791), mRNA 
0   NM_130666.2  CG2681-RA (CG2681), mRNA 
0   11  NM_167381.1  CG32625-RA (CG32625), mRNA 
0   NM_057512.3  CG3724-RA (Pgd), mRNA 
0   NM_079717.2  CG6703-RB, transcript variant B (Caki), mRNA 
0   NM_169971.1  CG6703-RC, transcript variant C (Caki), mRNA 
0   NM_169970.1  CG6703-RA, transcript variant A (Caki), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_057946.3  CG2863-RA (Nle), mRNA 
0   NM_164438.1  CG31936-RA (Gr22e), mRNA 
0   NM_135917.2  CG18480-RA (CG18480), mRNA 
0   NM_166257.1  CG5785-RB (thr), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_169191.2  CG31146-RD (CG31146), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.