National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17148R-1 
 Symbol Est-P  Full Name Esterase P 
 CG No CG17148  Old CG No CG17148 
 Synonyms Est-7, PsiEst-6, EST-5, Est-5, ESTP, EstP, est-P, yEst-6, CG17148, Est-P, yEst6 
 Accession No (Link to NCBI) NM_176323.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGTTGTGCCTGACTTTGCT 
 Primer Seq. 3'
aatctagaggtaccTTCCCGGCAAGTGTCTATCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGTCGTGC CTGACTTTGC TGTGGATAGC AGCTTTAGAA TCTGAAGCTG ATCCCTTGAT 
0061 TGTTGAGATA ACAAATGGAA AAATCCGTGG CAAAGATAAT GGGTTGTACT ACAGCTACGA 
0121 ATCGATTCCC AATGCCGAGC ATCCAACTGG TGCCCTCCGT TTTGAAGCAC CTCAGCCGTA 
0181 TAGTCATCAT TGGACTGATG TTTTCAATGC CACGCAGTCT CCAGTTGAGT GCATGCAGTG 
0241 GAATCAGTTT ATAAACGAAA ACAATAAGCT GATGGGTGAT GAGGATTGCT TAACGGTAAG 
0301 CATCTATAAG CCAAAGAAAC CCAATCGGAG CAGCTTTCCT GTCGTAGTAC TCCTGCATGG 
0361 AGGTGCTTTC ATGTTCGGTA GTGGATCCAT ATATGGACAC GACTCCATTA TGCGTGAGGG 
0421 AACTTTGCTT GTGGTAAAAA TAAGCTATCG TCTTGGACCA TTGGGTTTTG CAAGTACCGG 
0481 CGATAGACAC TTGCCGGGAA  
 in silico PCR Fragment
0001 GCTGTTGTGC CTGACTTTGC TGTGGATAGC AGCTTTAGAA TCTGAAGCTG ATCCCTTGAT 
0061 TGTTGAGATA ACAAATGGAA AAATCCGTGG CAAAGATAAT GGGTTGTACT ACAGCTACGA 
0121 ATCGATTCCC AATGCCGAGC ATCCAACTGG TGCCCTCCGT TTTGAAGCAC CTCAGCCGTA 
0181 TAGTCATCAT TGGACTGATG TTTTCAATGC CACGCAGTCT CCAGTTGAGT GCATGCAGTG 
0241 GAATCAGTTT ATAAACGAAA ACAATAAGCT GATGGGTGAT GAGGATTGCT TAACGGTAAG 
0301 CATCTATAAG CCAAAGAAAC CCAATCGGAG CAGCTTTCCT GTCGTAGTAC TCCTGCATGG 
0361 AGGTGCTTTC ATGTTCGGTA GTGGATCCAT ATATGGACAC GACTCCATTA TGCGTGAGGG 
0421 AACTTTGCTT GTGGTAAAAA TAAGTTTTGG TCTTGGACCA TTGGGTTTTG CAAGTACCGG 
0481 CGATAGACAC TTGCCGGGAA  
 Assemble Data

17148R-1.IR_full       1   GCTGTCGTGCCTGACTTTGCTGTGGATAGCAGCTTTAGAATCTGAAGCTGATCCCTTGAT 60
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     1   GCTGTTGTGCCTGACTTTGCTGTGGATAGCAGCTTTAGAATCTGAAGCTGATCCCTTGAT 60


17148R-1.IR_full       61  TGTTGAGATAACAAATGGAAAAATCCGTGGCAAAGATAATGGGTTGTACTACAGCTACGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     61  TGTTGAGATAACAAATGGAAAAATCCGTGGCAAAGATAATGGGTTGTACTACAGCTACGA 120


17148R-1.IR_full       121 ATCGATTCCCAATGCCGAGCATCCAACTGGTGCCCTCCGTTTTGAAGCACCTCAGCCGTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     121 ATCGATTCCCAATGCCGAGCATCCAACTGGTGCCCTCCGTTTTGAAGCACCTCAGCCGTA 180


17148R-1.IR_full       181 TAGTCATCATTGGACTGATGTTTTCAATGCCACGCAGTCTCCAGTTGAGTGCATGCAGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     181 TAGTCATCATTGGACTGATGTTTTCAATGCCACGCAGTCTCCAGTTGAGTGCATGCAGTG 240


17148R-1.IR_full       241 GAATCAGTTTATAAACGAAAACAATAAGCTGATGGGTGATGAGGATTGCTTAACGGTAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     241 GAATCAGTTTATAAACGAAAACAATAAGCTGATGGGTGATGAGGATTGCTTAACGGTAAG 300


17148R-1.IR_full       301 CATCTATAAGCCAAAGAAACCCAATCGGAGCAGCTTTCCTGTCGTAGTACTCCTGCATGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     301 CATCTATAAGCCAAAGAAACCCAATCGGAGCAGCTTTCCTGTCGTAGTACTCCTGCATGG 360


17148R-1.IR_full       361 AGGTGCTTTCATGTTCGGTAGTGGATCCATATATGGACACGACTCCATTATGCGTGAGGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17148R-1.in silico     361 AGGTGCTTTCATGTTCGGTAGTGGATCCATATATGGACACGACTCCATTATGCGTGAGGG 420


17148R-1.IR_full       421 AACTTTGCTTGTGGTAAAAATAAGCTATCGTCTTGGACCATTGGGTTTTGCAAGTACCGG 480
                           |||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||
17148R-1.in silico     421 AACTTTGCTTGTGGTAAAAATAAGTTTTGGTCTTGGACCATTGGGTTTTGCAAGTACCGG 480


17148R-1.IR_full       481 CGATAGACACTTGCCGGGAA 500
                           ||||||||||||||||||||
17148R-1.in silico     481 CGATAGACACTTGCCGGGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176323.1  CG17148-RA (Est-P), mRNA 
1.24   13  23  NM_176322.1  CG6917-RA (Est-6), mRNA 
0   NM_165428.2  CG10395-RB, transcript variant B (CG10395), mRNA 
0   NM_136323.3  CG10395-RA, transcript variant A (CG10395), mRNA 
0   NM_139491.1  CG1241-RA (Atg2), mRNA 
0   NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
0   NM_079174.2  CG11495-RA (rasp), mRNA 
0   NM_206522.1  CG4241-RC, transcript variant C (att-ORFA), mRNA 
0   NM_142634.2  CG4241-RA, transcript variant A (att-ORFA), mRNA 
0   NM_166195.1  CG5522-RE, transcript variant E (CG5522), mRNA 
0   NM_166196.1  CG5522-RD, transcript variant D (CG5522), mRNA 
0   NM_166193.1  CG5522-RA, transcript variant A (CG5522), mRNA 
0   NM_137314.2  CG5522-RC, transcript variant C (CG5522), mRNA 
0   NM_166194.1  CG5522-RB, transcript variant B (CG5522), mRNA 
0   NM_166197.1  CG5522-RF, transcript variant F (CG5522), mRNA 
0   NM_141577.2  CG11776-RA (CG11776), mRNA 
0   NM_058088.3  CG8730-RA (drosha), mRNA 
0   NM_135222.2  CG11188-RA (CG11188), mRNA 
0   NM_001015505.1  CG17866-PA.3 (CG17866), mRNA 
0   NM_132163.2  CG2079-RA (Dok), mRNA 
0   NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0   NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0   NM_140735.1  CG6311-RB (CG6311), mRNA 
0   NM_169049.1  CG12000-RB, transcript variant B (CG12000), mRNA 
0   NM_141272.1  CG12000-RA, transcript variant A (CG12000), mRNA 
0   NM_141239.1  CG17735-RA (CG17735), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   NM_136037.2  CG10275-RA (CG10275), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.