National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17146R-3 
 Symbol Adk1  Full Name Adenylate kinase-1 
 CG No CG17146  Old CG No CG17146 
 Synonyms DAK1, bs34e10.y1, AK1, ADK-1, CG17146, Adk1 
 Accession No (Link to NCBI) NM_079314.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATCATCTGGATCTTGGGTGG 
 Primer Seq. 3'
aatctagaggtaccCGGCATTGATCGTAAGGGTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATCATCTGG ATCTTGGGTG GACCCGGGTG CGGCAAGGGC ACTCAGTGCG CCAAAATCGT 
0061 GGAAAAATAC GGATTCACAC ATCTGAGCAG CGGCGANTTT GCTGCGCAAT GAGGTGGCTT 
0121 CTGGATCGGA CAAGGGTCGT CAGCTGCAGG CTGTGATGGC CAGCGGTGGC CTGGTGTCCA 
0181 ACGACGAGGT GCTGTCCCTG CTGAACGACG CCATCACGCG GGCCAAGGGT AGCTCGAAGG 
0241 GATTCCTCAT CGATGGATAT CCGCGTCAGA AGAACCAGGG CATTGAGTTC GAGGCGCGCA 
0301 TTGCACCCGC CGATCTGGCG CTGTACTTTG AGTGCTCCGA GGACACGATG GTGCAGCGCA 
0361 TCATGGCACG TGCCGCTGCC TCGGCGGTGA AACGGGACGA TGACAACGAG AAGACCATTA 
0421 GGGCACGCCT CCTGACCTTC AAGCAGAACA CCAATGCAAT TTTGGAACTT TATGAGCCCA 
0481 AAACCCTTAC GATCAATGCC G 
 in silico PCR Fragment
0001 CATCATCTGG ATCTTGGGTG GACCCGGGTG CGGCAAGGGC ACTCAGTGCG CCAAAATCGT 
0061 GGAAAAATAC GGATTCACAC ATCTGAGCAG CGGCGA-TTT GCTGCGCAAT GAGGTGGCTT 
0121 CTGGATCGGA CAAGGGTCGT CAGCTGCAGG CTGTGATGGC CAGCGGTGGC CTGGTGTCCA 
0181 ACGACGAGGT GCTGTCCCTG CTGAACGACG CCATCACGCG GGCCAAGGGT AGCTCGAAGG 
0241 GATTCCTCAT CGATGGATAT CCGCGTCAGA AGAACCAGGG CATTGAGTTC GAGGCGCGCA 
0301 TTGCACCCGC CGATCTGGCG CTGTACTTTG AGTGCTCCGA GGACACGATG GTGCAGCGCA 
0361 TCATGGCACG TGCCGCTGCC TCGGCGGTGA AACGGGACGA TGACAACGAG AAGACCATTA 
0421 GGGCACGCCT CCTGACCTTC AAGCAGAACA CCAATGCAAT TTTGGAACTT TATGAGCCCA 
0481 AAACCCTTAC GATCAATGCC G 
 Assemble Data

17146R-3.IR_full       1   CATCATCTGGATCTTGGGTGGACCCGGGTGCGGCAAGGGCACTCAGTGCGCCAAAATCGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     1   CATCATCTGGATCTTGGGTGGACCCGGGTGCGGCAAGGGCACTCAGTGCGCCAAAATCGT 60


17146R-3.IR_full       61  GGAAAAATACGGATTCACACATCTGAGCAGCGGCGANTTTGCTGCGCAATGAGGTGGCTT 120
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
17146R-3.in silico     61  GGAAAAATACGGATTCACACATCTGAGCAGCGGCGA-TTTGCTGCGCAATGAGGTGGCTT 120


17146R-3.IR_full       121 CTGGATCGGACAAGGGTCGTCAGCTGCAGGCTGTGATGGCCAGCGGTGGCCTGGTGTCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     121 CTGGATCGGACAAGGGTCGTCAGCTGCAGGCTGTGATGGCCAGCGGTGGCCTGGTGTCCA 180


17146R-3.IR_full       181 ACGACGAGGTGCTGTCCCTGCTGAACGACGCCATCACGCGGGCCAAGGGTAGCTCGAAGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     181 ACGACGAGGTGCTGTCCCTGCTGAACGACGCCATCACGCGGGCCAAGGGTAGCTCGAAGG 240


17146R-3.IR_full       241 GATTCCTCATCGATGGATATCCGCGTCAGAAGAACCAGGGCATTGAGTTCGAGGCGCGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     241 GATTCCTCATCGATGGATATCCGCGTCAGAAGAACCAGGGCATTGAGTTCGAGGCGCGCA 300


17146R-3.IR_full       301 TTGCACCCGCCGATCTGGCGCTGTACTTTGAGTGCTCCGAGGACACGATGGTGCAGCGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     301 TTGCACCCGCCGATCTGGCGCTGTACTTTGAGTGCTCCGAGGACACGATGGTGCAGCGCA 360


17146R-3.IR_full       361 TCATGGCACGTGCCGCTGCCTCGGCGGTGAAACGGGACGATGACAACGAGAAGACCATTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     361 TCATGGCACGTGCCGCTGCCTCGGCGGTGAAACGGGACGATGACAACGAGAAGACCATTA 420


17146R-3.IR_full       421 GGGCACGCCTCCTGACCTTCAAGCAGAACACCAATGCAATTTTGGAACTTTATGAGCCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17146R-3.in silico     421 GGGCACGCCTCCTGACCTTCAAGCAGAACACCAATGCAATTTTGGAACTTTATGAGCCCA 480


17146R-3.IR_full       481 AAACCCTTACGATCAATGCCG 501
                           |||||||||||||||||||||
17146R-3.in silico     481 AAACCCTTACGATCAATGCCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079314.2  CG17146-RA, transcript variant A (Adk1), mRNA 
100   482  NM_168493.1  CG17146-RB, transcript variant B (Adk1), mRNA 
0.2   NM_132539.2  CG1559-RA (Upf1), mRNA 
0   NM_136455.1  CG2093-RA (CG2093), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_137737.1  CG9822-RA (CG9822), mRNA 
0   NM_133058.2  CG6123-RA (CG6123), mRNA 
0   NM_140569.2  CG5841-RA (mib1), mRNA 
0   NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_143375.1  CG14061-RA (CG14061), mRNA 
0   NM_137816.1  CG5819-RA, transcript variant A (CG5819), mRNA 
0   NM_166523.1  CG5819-RB, transcript variant B (CG5819), mRNA 
0   NM_141048.1  CG7324-RA (CG7324), mRNA 
0   NM_134811.2  CG10880-RA (CG10880), mRNA 
0   NM_078600.2  CG10521-RA (NetB), mRNA 
0   NM_164911.1  CG5603-RB, transcript variant B (CYLD), mRNA 
0   NM_132678.2  CG2691-RA (CG2691), mRNA 
0   NM_164797.1  CG8475-RB, transcript variant B (CG8475), mRNA 
0   NM_135345.2  CG8475-RA, transcript variant A (CG8475), mRNA 
0   NM_164577.1  CG15427-RC, transcript variant C (tutl), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 
0   NM_080127.4  CG15427-RE, transcript variant E (tutl), mRNA 
0   NM_140762.1  CG5535-RA, transcript variant A (CG5535), mRNA 
0   NM_168753.1  CG5535-RB, transcript variant B (CG5535), mRNA 
0   NM_165691.2  CG30002-RA (CG30002), mRNA 
0   NM_137687.2  CG15651-RA (CG15651), mRNA 
0   NM_134733.2  CG4775-RA (Tango14), mRNA 
0   NM_001038743.1  CG33980-RA (CG33980), mRNA 
0   NM_142829.1  CG4907-RA (CG4907), mRNA 
0   NM_142780.2  CG13855-RA (CG13855), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.