National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17144R-1 
 Symbol CG17144  Full Name CG17144 
 CG No CG17144  Old CG No CG17144 
 Synonyms CG17144 
 Accession No (Link to NCBI) NM_140303.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACATTCCGGCTTATACCC 
 Primer Seq. 3'
aatctagaggtaccCTGTTCCTGCTGCTTGCGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGACATTCC GGCTTATACC CACCAAACGG CCACCCAGGC GCGTCAGTAC CGCCATCGTC 
0061 ATCACAAACA GCGCCAGATA TGCAATGGCG GCACTGTTAG CTACGAGAAT CAGTTGGCCA 
0121 ACGCCAGCAG CGAGGATGAG CTGGATGATC CAGATGTTGT GGTCGTGGGA AGTCCCGAAG 
0181 TGATGGCTGC CGTGgNNGCC ATNAGCCTCC AATAAGGCAA GAGAAATGCG CAACCGCAGC 
0241 GGNAAGCTAT AGCAATCTCT TCGATGCTGA CTTCGAGGCG GCACTGGTCA ACTCCTCGTT 
0301 GGCGGATAAC CATGTCAGAG GTGAAGGAGC AAGCAGTTCC GGGAAGCCAT CTGCGGGCGC 
0361 AGCTCTATTA GCGGCTGCCA TCAGTGGAAA AACGGAGAAC ATGTATAGCA ATGTGTTGCC 
0421 AGTGGACAAT GATACGGATC CGGCCGATTC CACGCTGCAT GTATACTCCA ATATCATCGA 
0481 TGAACGCAAG CAGCAGGAAC AG 
 in silico PCR Fragment
0001 TGGACATTCC GGCTTATACC CACCAAACGG CCACCCAGGC GCGTCAGTAC CGCCATCGTC 
0061 ATCACAAACA GCGCCAGATA TGCAATGGCG GCACTGTTAG CTATGAGAAT CAGTTGGCCA 
0121 ACGCCAGCAG CGAGGATGAG CTGGATGATC CAGATGTTGT GGTCGTGGGC AGTCCCGAAG 
0181 TGGTGGCTGC CGTGGCAGCC AT-AGCCTCC AATAAGGCAA GAGAAATGCG CAACCGCAGC 
0241 GG-AAGCTAT AGCAATCTCT TCGATGCTGA CTTCGAGGCG GCACTGGTCA ACTCCTCATT 
0301 GGCGGATAAC CATGTCAGAG GTGAAGGAGC AAGCAGTTCC GGAAAGCCCT CTGCGGGCGC 
0361 AGCTCTATTA GCGGCTGCCA TCAGTGGAAA AACGGAGAAC ATGTATAGCA ATGTGTTGCC 
0421 AGTGGACAAT GATACGGATC CGGCCGATTC CACGCTGCAT GTATACTCCA ATATCATCGA 
0481 TGAACGCAAG CAGCAGGAAC AG 
 Assemble Data

17144R-1.IR_full       1   TGGACATTCCGGCTTATACCCACCAAACGGCCACCCAGGCGCGTCAGTACCGCCATCGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17144R-1.in silico     1   TGGACATTCCGGCTTATACCCACCAAACGGCCACCCAGGCGCGTCAGTACCGCCATCGTC 60


17144R-1.IR_full       61  ATCACAAACAGCGCCAGATATGCAATGGCGGCACTGTTAGCTACGAGAATCAGTTGGCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
17144R-1.in silico     61  ATCACAAACAGCGCCAGATATGCAATGGCGGCACTGTTAGCTATGAGAATCAGTTGGCCA 120


17144R-1.IR_full       121 ACGCCAGCAGCGAGGATGAGCTGGATGATCCAGATGTTGTGGTCGTGGGAAGTCCCGAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
17144R-1.in silico     121 ACGCCAGCAGCGAGGATGAGCTGGATGATCCAGATGTTGTGGTCGTGGGCAGTCCCGAAG 180


17144R-1.IR_full       181 TGATGGCTGCCGTGGNNGCCATNAGCCTCCAATAAGGCAAGAGAAATGCGCAACCGCAGC 240
                           || ||||||||||||  ||||| |||||||||||||||||||||||||||||||||||||
17144R-1.in silico     181 TGGTGGCTGCCGTGGCAGCCAT-AGCCTCCAATAAGGCAAGAGAAATGCGCAACCGCAGC 240


17144R-1.IR_full       241 GGNAAGCTATAGCAATCTCTTCGATGCTGACTTCGAGGCGGCACTGGTCAACTCCTCGTT 300
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
17144R-1.in silico     241 GG-AAGCTATAGCAATCTCTTCGATGCTGACTTCGAGGCGGCACTGGTCAACTCCTCATT 300


17144R-1.IR_full       301 GGCGGATAACCATGTCAGAGGTGAAGGAGCAAGCAGTTCCGGGAAGCCATCTGCGGGCGC 360
                           |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
17144R-1.in silico     301 GGCGGATAACCATGTCAGAGGTGAAGGAGCAAGCAGTTCCGGAAAGCCCTCTGCGGGCGC 360


17144R-1.IR_full       361 AGCTCTATTAGCGGCTGCCATCAGTGGAAAAACGGAGAACATGTATAGCAATGTGTTGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17144R-1.in silico     361 AGCTCTATTAGCGGCTGCCATCAGTGGAAAAACGGAGAACATGTATAGCAATGTGTTGCC 420


17144R-1.IR_full       421 AGTGGACAATGATACGGATCCGGCCGATTCCACGCTGCATGTATACTCCAATATCATCGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17144R-1.in silico     421 AGTGGACAATGATACGGATCCGGCCGATTCCACGCTGCATGTATACTCCAATATCATCGA 480


17144R-1.IR_full       481 TGAACGCAAGCAGCAGGAACAG 502
                           ||||||||||||||||||||||
17144R-1.in silico     481 TGAACGCAAGCAGCAGGAACAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140303.1  CG17144-RA (CG17144), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_134991.2  CG15438-RA (CG15438), mRNA 
0   NM_169114.1  CG1213-RC, transcript variant C (CG1213), mRNA 
0   NM_141342.1  CG1213-RA, transcript variant A (CG1213), mRNA 
0   NM_169113.1  CG1213-RB, transcript variant B (CG1213), mRNA 
0   NM_137196.1  CG12964-RA (CG12964), mRNA 
0   NM_165933.1  CG8632-RB, transcript variant B (CG8632), mRNA 
0   NM_136962.2  CG8632-RA, transcript variant A (CG8632), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   NM_057309.2  CG6534-RA (slou), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_138014.1  CG13566-RA (CG13566), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_136328.2  CG30440-RA (CG30440), mRNA 
0   NM_143378.2  CG1523-RA (CG1523), mRNA 
0   NM_141755.2  CG14691-RA, transcript variant A (CG14691), mRNA 
0   NM_176456.1  CG14691-RB, transcript variant B (CG14691), mRNA 
0   NM_001015255.1  CG17163-PA.3 (CG17163), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_136069.2  CG10600-RA (CG10600), mRNA 
0   NM_140937.2  CG17149-RA, transcript variant A (CG17149), mRNA 
0   NM_168835.1  CG17149-RB, transcript variant B (CG17149), mRNA 
0   NM_078832.2  CG6716-RA, transcript variant A (prd), mRNA 
0   NM_164990.2  CG6716-RB, transcript variant B (prd), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
DM
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.