National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17131R-4 
 Symbol SP71  Full Name SP71 
 CG No CG17131  Old CG No CG17131 
 Synonyms CG17131, CG17131-ORFA, CG17131-ORFB, SP71 
 Accession No (Link to NCBI) NM_001031861.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTCGTCCTGGTGACTTTG 
 Primer Seq. 3'
aatctagaggtaccCTATCCGAATCACTGAGCACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGTCGTCC TGGTGACTTT GCCTGAACAG ATAAATGCTC GTATGGCATT TGAAAAGCTA 
0061 ACGGACTTTG ATTTTCCGGG CAACACGTAT TACAGCGTGA AAAACCTTTC ACTGTATGAG 
0121 TGTCAAGGAT GGTGTCGCGA GGAGGCAGAT TgCCAAGCGG CGGCCTTTAG TTTTGTGGTT 
0181 AACCCTCTGT CGCCTTCGCA AGAGACCCAC TGTCAATTGC AGAACGACTC CTCCGCAGCC 
0241 AATCCTTCGG CAGCTCCGCA AAGAAGCGCA AACATGTACT ACATGATAAA AATTGCAGCT 
0301 GCGCAGCGAG AATGTGTGCC ACCGACCGTG GAGTTTCGAG AGGGTTCCAA ACAAGGTGAT 
0361 CCGCGGCCTG GACAATGCAC TAATATACAC CAGTACAAAA GAGGCCTGCT TATCAGCTTG 
0421 CCTCAACGAA AGACGATTCG TATGCCGATC TGTGGAGTAT GATTATAACA ACATGAAGTG 
0481 TGTGCTCAGT GATTCGGATA G 
 in silico PCR Fragment
0001 ATGGTCGTCC TGGTGACTTT GCCTGAACAG ATAAATGCTC GTATGGCATT TGAAAAGCTA 
0061 ACGGACTTTG ATTTTCCGGG CAACACGTAT TACAGCGTGA AAAACCTTTC ACTGTATGAG 
0121 TGTCAAGGAT GGTGTCGCGA GGAGGCAGAT TGCCAAGCGG CGGCCTTTAG TTTTGTGGTT 
0181 AACCCTCTGT CGCCTTCGCA AGAGACCCAC TGTCAATTGC AGAACGACTC CTCCGCAGCC 
0241 AATCCTTCGG CAGCTCCGCA AAGAAGCGCA AACATGTACT ACATGAT-AA AATTGCAGCT 
0301 GCGCAGCGAG AATGTGTGCC ACCGACCGTG GAGTTTCGAG AGGGTTCCAA ACAAGGTGAT 
0361 CCGCGGCCTG GACAATGCAC TAATATACAC CAGTACAAAA GAGGCCTGCT TATCAGCTTG 
0421 CCTCAACGAA AGACGATTCG TATGCCGATC TGTGGAGTAT GATTATAACA ACATGAAGTG 
0481 TGTGCTCAGT GATTCGGATA G 
 Assemble Data

17131R-4.IR_full       1   ATGGTCGTCCTGGTGACTTTGCCTGAACAGATAAATGCTCGTATGGCATTTGAAAAGCTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     1   ATGGTCGTCCTGGTGACTTTGCCTGAACAGATAAATGCTCGTATGGCATTTGAAAAGCTA 60


17131R-4.IR_full       61  ACGGACTTTGATTTTCCGGGCAACACGTATTACAGCGTGAAAAACCTTTCACTGTATGAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     61  ACGGACTTTGATTTTCCGGGCAACACGTATTACAGCGTGAAAAACCTTTCACTGTATGAG 120


17131R-4.IR_full       121 TGTCAAGGATGGTGTCGCGAGGAGGCAGATTGCCAAGCGGCGGCCTTTAGTTTTGTGGTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     121 TGTCAAGGATGGTGTCGCGAGGAGGCAGATTGCCAAGCGGCGGCCTTTAGTTTTGTGGTT 180


17131R-4.IR_full       181 AACCCTCTGTCGCCTTCGCAAGAGACCCACTGTCAATTGCAGAACGACTCCTCCGCAGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     181 AACCCTCTGTCGCCTTCGCAAGAGACCCACTGTCAATTGCAGAACGACTCCTCCGCAGCC 240


17131R-4.IR_full       241 AATCCTTCGGCAGCTCCGCAAAGAAGCGCAAACATGTACTACATGATAAAAATTGCAGCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
17131R-4.in silico     241 AATCCTTCGGCAGCTCCGCAAAGAAGCGCAAACATGTACTACATGAT-AAAATTGCAGCT 300


17131R-4.IR_full       301 GCGCAGCGAGAATGTGTGCCACCGACCGTGGAGTTTCGAGAGGGTTCCAAACAAGGTGAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     301 GCGCAGCGAGAATGTGTGCCACCGACCGTGGAGTTTCGAGAGGGTTCCAAACAAGGTGAT 360


17131R-4.IR_full       361 CCGCGGCCTGGACAATGCACTAATATACACCAGTACAAAAGAGGCCTGCTTATCAGCTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     361 CCGCGGCCTGGACAATGCACTAATATACACCAGTACAAAAGAGGCCTGCTTATCAGCTTG 420


17131R-4.IR_full       421 CCTCAACGAAAGACGATTCGTATGCCGATCTGTGGAGTATGATTATAACAACATGAAGTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17131R-4.in silico     421 CCTCAACGAAAGACGATTCGTATGCCGATCTGTGGAGTATGATTATAACAACATGAAGTG 480


17131R-4.IR_full       481 TGTGCTCAGTGATTCGGATAG 501
                           |||||||||||||||||||||
17131R-4.in silico     481 TGTGCTCAGTGATTCGGATAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001031861.1  CG17131-RA, transcript variant A (SP71), mRNA 
100   482  NM_001038726.1  CG17131-RB, transcript variant B (SP71), mRNA 
0   NM_141318.2  CG2104-RA (CG2104), mRNA 
0   NM_165069.1  CG8954-RB, transcript variant B (Smg5), mRNA 
0   NM_135841.4  CG8954-RA, transcript variant A (Smg5), mRNA 
0   NM_142644.1  CG5466-RA (CG5466), mRNA 
0   NM_078902.2  CG8276-RB, transcript variant B (bin3), mRNA 
0   NM_165468.1  CG8276-RA, transcript variant A (bin3), mRNA 
0   NM_138199.2  CG3200-RA (Reg-2), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_142597.2  CG12254-RA (MED25), mRNA 
0   NM_142639.1  CG5417-RA (Srp14), mRNA 
0   NM_167318.1  CG1786-RA (Cyp318a1), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_001014665.1  CG4685-RD, transcript variant D (CG4685), mRNA 
0   NM_143151.2  CG4685-RA, transcript variant A (CG4685), mRNA 
0   NM_001014667.1  CG4685-RB, transcript variant B (CG4685), mRNA 
0   NM_001014666.1  CG4685-RC, transcript variant C (CG4685), mRNA 
0   NM_168091.1  CG32244-RB, transcript variant B (CG32244), mRNA 
0   NM_168092.1  CG32244-RC, transcript variant C (CG32244), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_001042849.1  CG40485-RA, transcript variant A (CG40485), mRNA 
0   NM_136003.2  CG6412-RA (CG6412), mRNA 
0   NM_001042848.1  CG40485-RB, transcript variant B (CG40485), mRNA 
0   NM_139717.1  CG5146-RA (CG5146), mRNA 
0   NM_133098.2  CG7053-RA (CG7053), mRNA 
0   NM_170165.1  CG31172-RA (CG31172), mRNA 
0   NM_170462.1  CG7943-RB, transcript variant B (CG7943), mRNA 
0   NM_143965.1  CG14310-RB, transcript variant B (CG14310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.