National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17131R-1 
 Symbol SP71  Full Name SP71 
 CG No CG17131  Old CG No CG17131 
 Synonyms CG17131, CG17131-ORFA, CG17131-ORFB, SP71 
 Accession No (Link to NCBI) NM_001031861.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGTCGTCCTGGTGACTTTGCCTGAACAGATAAATGCTCGTATGGCATTTGAAAAGCTA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGGACTTTGATTTTCCGGGCAACACGTATTACAGCGTGAAAAACCTTTCACTGTATGAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGTCAAGGATGGTGTCGCGAGGAGGCAGATTGCCAAGCGGCGGCCTTTAGTTTTGTGGTT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AACCCTCTGTCGCCTTCGCAAGAGACCCACTGTCAATTGCAGAACGACTCCTCCGCAGCC 240

                           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     241 AATCCTTCGGCAGCTCCGCAAAGAAGCGCAAACATGTACTACATGAT-AAAATTGCAGCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCGCAGCGAGAATGTGTGCCACCGACCGTGGAGTTTCGAGAGGGTTCCAAACAAGGTGAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGCGGCCTGGACAATGCACTAATATACACCAGTACAAAAGAGGCCTGCTTATCAGCTTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCTCAACGAAAGACGATTCGTATGCCGATCTGTGGAGTATGATTATAACAACATGAAGTG 480

17131R-1.IR_full       481 TGTGCTCAGTGATTCGGATAG 501
                           ||||||||||||||||||||| silico     481 TGTGCTCAGTGATTCGGATAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001031861.1  CG17131-RA, transcript variant A (SP71), mRNA 
100   482  NM_001038726.1  CG17131-RB, transcript variant B (SP71), mRNA 
0   NM_141318.2  CG2104-RA (CG2104), mRNA 
0   NM_165069.1  CG8954-RB, transcript variant B (Smg5), mRNA 
0   NM_135841.4  CG8954-RA, transcript variant A (Smg5), mRNA 
0   NM_142644.1  CG5466-RA (CG5466), mRNA 
0   NM_078902.2  CG8276-RB, transcript variant B (bin3), mRNA 
0   NM_165468.1  CG8276-RA, transcript variant A (bin3), mRNA 
0   NM_138199.2  CG3200-RA (Reg-2), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_142597.2  CG12254-RA (MED25), mRNA 
0   NM_142639.1  CG5417-RA (Srp14), mRNA 
0   NM_167318.1  CG1786-RA (Cyp318a1), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_001014665.1  CG4685-RD, transcript variant D (CG4685), mRNA 
0   NM_143151.2  CG4685-RA, transcript variant A (CG4685), mRNA 
0   NM_001014667.1  CG4685-RB, transcript variant B (CG4685), mRNA 
0   NM_001014666.1  CG4685-RC, transcript variant C (CG4685), mRNA 
0   NM_168091.1  CG32244-RB, transcript variant B (CG32244), mRNA 
0   NM_168092.1  CG32244-RC, transcript variant C (CG32244), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_001042849.1  CG40485-RA, transcript variant A (CG40485), mRNA 
0   NM_136003.2  CG6412-RA (CG6412), mRNA 
0   NM_001042848.1  CG40485-RB, transcript variant B (CG40485), mRNA 
0   NM_139717.1  CG5146-RA (CG5146), mRNA 
0   NM_133098.2  CG7053-RA (CG7053), mRNA 
0   NM_170165.1  CG31172-RA (CG31172), mRNA 
0   NM_170462.1  CG7943-RB, transcript variant B (CG7943), mRNA 
0   NM_143965.1  CG14310-RB, transcript variant B (CG14310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.