National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17086R-9 
 Symbol CG17086  Full Name CG17086 
 CG No CG17086  Old CG No CG17086 
 Synonyms CG17086 
 Accession No (Link to NCBI) NM_135620.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGACAGCGGTTCAGTGGAGT 
 Primer Seq. 3'
aatctagaggtaccAATCGGTTGGCCAGTTGGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGACAGCGG TTCAGTGGAG TCCGGTCTGC GGACGCTATC TGGTGGCCAA GGGAGCGATC 
0061 CGTGGCCACG GTCTGCTGAT CGAGGAGCTG CCCTTTGCCG TCGGGCCCAA GTGCAATGGA 
0121 CCGGTGGTGT GCCTGGGTTG CTACGAACCC AACCCAGATC CGGAGGAGGA GCTGTGTAGC 
0181 GAATGTGGCT GGCCGCTGTG CGTGGAGTGC GCCCAANAAC CAACAAGCGG ATAACGCCCA 
0241 TTTCCGCCTG GAGTGCAGCC AGCTGAAGGA TGCTCGGGCA CGATTCTTNC GCCTGcCCAG 
0301 CGGCAGCAGG CACTGTCCGC AATTGGACTG TATTATGCCG CTCAGAGTTC TGTTGGCCAA 
0361 GGAGGCGAAT CCGGAGCGAT GGGACAACGA GGTGGCACCC ATGGAGCACC ACAAGGAGGA 
0421 GCGCCAAAGG GACGCGGATG TCTGGCATgN GGATCGCGTT AATATCGCTC AGTATTTGCG 
0481 CGGTCCCTgC CAACTGGCCA ACCGATT 
 in silico PCR Fragment
0001 AGGACAGCGG TTCAGTGGAG TCCGGTCTGC GGACGCTATC TGGTGGCCAA GGGAGCGATC 
0061 CGTGGCCACG GTCTGCTGAT CGAGGAGCTG CCCTTTGCCG TCGGGCCCAA GTGCAATGGA 
0121 CCGGTGGTGT GCCTGGGTTG CTACGAACCC AACCCAGATC CGGAGGAGGA GCTGTGTAGC 
0181 GAATGTGGCT GGCCGCTGTG CGTGGAGTGC GC-------C CAACAAGCGG ATAACGCCCA 
0241 TTTCCGCCTG GAGTGCAGCC AGCTGAAGGA TGCTCGGGCA CGATTCTTCC GCCTGCCCAG 
0301 CGGCAGCAGG CACTGTCCGC AATTGGACTG TATTATGCCG CTCAGAGTTC TGTTGGCCAA 
0361 GGAGGCGAAT CCGGAGCGAT GGGACAACGA GGTGGCACCC ATGGAGCACC ACAAGGAGGA 
0421 GCGCCAAAGG GACGCGGATG TCTGGCATGC GGATCGCGTT AATATCGCTC AGTATTTGCG 
0481 CGGTCCCTGC CAACTGGCCA ACCGATT 
 Assemble Data

17086R-9.IR_full       1   AGGACAGCGGTTCAGTGGAGTCCGGTCTGCGGACGCTATCTGGTGGCCAAGGGAGCGATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17086R-9.in silico     1   AGGACAGCGGTTCAGTGGAGTCCGGTCTGCGGACGCTATCTGGTGGCCAAGGGAGCGATC 60


17086R-9.IR_full       61  CGTGGCCACGGTCTGCTGATCGAGGAGCTGCCCTTTGCCGTCGGGCCCAAGTGCAATGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17086R-9.in silico     61  CGTGGCCACGGTCTGCTGATCGAGGAGCTGCCCTTTGCCGTCGGGCCCAAGTGCAATGGA 120


17086R-9.IR_full       121 CCGGTGGTGTGCCTGGGTTGCTACGAACCCAACCCAGATCCGGAGGAGGAGCTGTGTAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17086R-9.in silico     121 CCGGTGGTGTGCCTGGGTTGCTACGAACCCAACCCAGATCCGGAGGAGGAGCTGTGTAGC 180


17086R-9.IR_full       181 GAATGTGGCTGGCCGCTGTGCGTGGAGTGCGCCCAANAACCAACAAGCGGATAACGCCCA 240
                           ||||||||||||||||||||||||||||||||       |||||||||||||||||||||
17086R-9.in silico     181 GAATGTGGCTGGCCGCTGTGCGTGGAGTGCGC-------CCAACAAGCGGATAACGCCCA 240


17086R-9.IR_full       241 TTTCCGCCTGGAGTGCAGCCAGCTGAAGGATGCTCGGGCACGATTCTTNCGCCTGCCCAG 300
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
17086R-9.in silico     241 TTTCCGCCTGGAGTGCAGCCAGCTGAAGGATGCTCGGGCACGATTCTTCCGCCTGCCCAG 300


17086R-9.IR_full       301 CGGCAGCAGGCACTGTCCGCAATTGGACTGTATTATGCCGCTCAGAGTTCTGTTGGCCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17086R-9.in silico     301 CGGCAGCAGGCACTGTCCGCAATTGGACTGTATTATGCCGCTCAGAGTTCTGTTGGCCAA 360


17086R-9.IR_full       361 GGAGGCGAATCCGGAGCGATGGGACAACGAGGTGGCACCCATGGAGCACCACAAGGAGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17086R-9.in silico     361 GGAGGCGAATCCGGAGCGATGGGACAACGAGGTGGCACCCATGGAGCACCACAAGGAGGA 420


17086R-9.IR_full       421 GCGCCAAAGGGACGCGGATGTCTGGCATGNGGATCGCGTTAATATCGCTCAGTATTTGCG 480
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
17086R-9.in silico     421 GCGCCAAAGGGACGCGGATGTCTGGCATGCGGATCGCGTTAATATCGCTCAGTATTTGCG 480


17086R-9.IR_full       481 CGGTCCCTGCCAACTGGCCAACCGATT 507
                           |||||||||||||||||||||||||||
17086R-9.in silico     481 CGGTCCCTGCCAACTGGCCAACCGATT 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135620.2  CG17086-RA (CG17086), mRNA 
0.2   NM_143583.3  CG11317-RA (CG11317), mRNA 
0   NM_140006.1  CG5751-RA (TrpA1), mRNA 
0   NM_142707.2  CG3301-RA, transcript variant A (CG3301), mRNA 
0   NM_169954.1  CG3301-RB, transcript variant B (CG3301), mRNA 
0   NM_080049.2  CG11614-RA (nkd), mRNA 
0   NM_137871.2  CG3536-RA (CG3536), mRNA 
0   NM_166551.2  CG30267-RA (CG30267), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_143270.2  CG6265-RA, transcript variant A (Nep5), mRNA 
0   NM_170307.1  CG6265-RB, transcript variant B (Nep5), mRNA 
0   NM_057773.3  CG7538-RA (Mcm2), mRNA 
0   NM_058037.3  CG9677-RA (Int6), mRNA 
0   NM_079728.4  CG31289-RA (Dph5), mRNA 
0   NM_140708.2  CG6485-RA (CG6485), mRNA 
0   NM_167628.1  CG6816-RA, transcript variant A (Cyp18a1), mRNA 
0   NM_078679.2  CG6816-RB, transcript variant B (Cyp18a1), mRNA 
0   NM_140513.3  CG7841-RA (CG7841), mRNA 
0   NM_080122.2  CG7001-RA (Pk17E), mRNA 
0   NM_164800.1  CG8372-RB, transcript variant B (CG8372), mRNA 
0   NM_135350.2  CG8372-RA, transcript variant A (CG8372), mRNA 
0   NM_134936.2  CG8843-RA (sec5), mRNA 
0   NM_142699.1  CG5871-RA (CG5871), mRNA 
0   NM_143453.1  CG7582-RA (CG7582), mRNA 
0   NM_167989.1  CG11537-RB, transcript variant B (CG11537), mRNA 
0   NM_167988.1  CG11537-RA, transcript variant A (CG11537), mRNA 
0   NM_140866.1  CG9299-RA (CG9299), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.