National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17084R-3 
 Symbol mthl9  Full Name methuselah-like 9 
 CG No CG17084  Old CG No CG17084 
 Synonyms Mth-9, CG17084, anon-WO0170980.164, anon-WO0170980.163, mthl9 
 Accession No (Link to NCBI) NM_138185.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTACGGATGGACTGCGGATGA 
 Primer Seq. 3'
aatctagaggtaccTTGAAAGCGTTCGCAGTTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTACGGATGG ACTGCGGATG AAGGATGGCT CCTACTCATA CGCTGGAGTA GTGGTCCCAC 
0061 CGCATCTGAT GGCGGAGTAC TCCTTCAAGG TGATCGATGG AGTGGAGTAC CGGGCCAAGA 
0121 AACATNCTGC GCGGCTGCGT CNTGTCTNGC TGAAAGCCCT GCATCAGTTT CTGTTGTCCG 
0181 GAGAACCTCG TCTTTGATGC CAAGCACTGG AACTGCACAA TGCCACACCA AGTCCGCGAG 
0241 TCCACTCACG TGGAGCTCAC CTACGCTAAC AGGACTGTGG ATCAANGTAC GCATACGCGA 
0301 TCGTTTTGTG GTGCGCACAG AGCTGGGTTG CCGGAACAAA TTCGTGGACA AAAAGCACGA 
0361 TAACTTCTGG CAATGGGACC TCTTCGAGAA TGGAACTCTG CGGCGGGACA ATCGTCTGTG 
0421 GTCAACGGAT GAGTATTGCT TTAGCCCGTT GGAGCACAAT CCGGAGCAGT GGGAGCTCAC 
0481 TCCGCTCAAC TGCGAACGCT TTCAA 
 in silico PCR Fragment
0001 TTACGGATGG ACTGCGGATG AAGGATGGCT CCTACTCATA CGCTGGAGTA GTGGTCCCAC 
0061 CGCATCTGAT GGCGGAGTAC TCCTTCAAGG TGATCGATGG AGTGGAGTAC CGGGCCAAGA 
0121 AACAT-CTGC GCGGCTGCGT C-TGTCT-GC TG-AAGCCCT GCATCAGTTT CTGTTGTCCG 
0181 GAGAACCTCG TCTTTGATGC CAAGCACTGG AACTGCACAA TGCCACACCA AGTCCGCGAG 
0241 TCCACTCACG TGGAGCTCAC CTACGCTAAC AGGACTGTGG ATCAA-GTAC GCATACGCGA 
0301 TCGTTTTGTG GTGCGCACAG AGCTGGGTTG CCGGAACAAA TTCGTGGACA AAAAGCACGA 
0361 TAACTTCTGG CAATGGGACC TCTTCGAGAA TGGAACTCTG CGGCGGGACA ATCGTCTGTG 
0421 GTCAACGGAT GAGTATTGCT TTAGCCCGTT GGAGCACAAT CCGGAGCAGT GGGAGCTCAC 
0481 TCCGCTCAAC TGCGAACGCT TTCAA 
 Assemble Data

17084R-3.IR_full       1   TTACGGATGGACTGCGGATGAAGGATGGCTCCTACTCATACGCTGGAGTAGTGGTCCCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17084R-3.in silico     1   TTACGGATGGACTGCGGATGAAGGATGGCTCCTACTCATACGCTGGAGTAGTGGTCCCAC 60


17084R-3.IR_full       61  CGCATCTGATGGCGGAGTACTCCTTCAAGGTGATCGATGGAGTGGAGTACCGGGCCAAGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17084R-3.in silico     61  CGCATCTGATGGCGGAGTACTCCTTCAAGGTGATCGATGGAGTGGAGTACCGGGCCAAGA 120


17084R-3.IR_full       121 AACATNCTGCGCGGCTGCGTCNTGTCTNGCTGAAAGCCCTGCATCAGTTTCTGTTGTCCG 180
                           ||||| ||||||||||||||| ||||| |||| |||||||||||||||||||||||||||
17084R-3.in silico     121 AACAT-CTGCGCGGCTGCGTC-TGTCT-GCTG-AAGCCCTGCATCAGTTTCTGTTGTCCG 180


17084R-3.IR_full       181 GAGAACCTCGTCTTTGATGCCAAGCACTGGAACTGCACAATGCCACACCAAGTCCGCGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17084R-3.in silico     181 GAGAACCTCGTCTTTGATGCCAAGCACTGGAACTGCACAATGCCACACCAAGTCCGCGAG 240


17084R-3.IR_full       241 TCCACTCACGTGGAGCTCACCTACGCTAACAGGACTGTGGATCAANGTACGCATACGCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
17084R-3.in silico     241 TCCACTCACGTGGAGCTCACCTACGCTAACAGGACTGTGGATCAA-GTACGCATACGCGA 300


17084R-3.IR_full       301 TCGTTTTGTGGTGCGCACAGAGCTGGGTTGCCGGAACAAATTCGTGGACAAAAAGCACGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17084R-3.in silico     301 TCGTTTTGTGGTGCGCACAGAGCTGGGTTGCCGGAACAAATTCGTGGACAAAAAGCACGA 360


17084R-3.IR_full       361 TAACTTCTGGCAATGGGACCTCTTCGAGAATGGAACTCTGCGGCGGGACAATCGTCTGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17084R-3.in silico     361 TAACTTCTGGCAATGGGACCTCTTCGAGAATGGAACTCTGCGGCGGGACAATCGTCTGTG 420


17084R-3.IR_full       421 GTCAACGGATGAGTATTGCTTTAGCCCGTTGGAGCACAATCCGGAGCAGTGGGAGCTCAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17084R-3.in silico     421 GTCAACGGATGAGTATTGCTTTAGCCCGTTGGAGCACAATCCGGAGCAGTGGGAGCTCAC 480


17084R-3.IR_full       481 TCCGCTCAACTGCGAACGCTTTCAA 505
                           |||||||||||||||||||||||||
17084R-3.in silico     481 TCCGCTCAACTGCGAACGCTTTCAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138185.2  CG17084-RA (mthl9), mRNA 
0   NM_057826.3  CG10043-RA, transcript variant A (rtGEF), mRNA 
0   NM_165327.1  CG10043-RB, transcript variant B (rtGEF), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_164600.2  CG31660-RB, transcript variant B (CG31660), mRNA 
0   NM_001014465.1  CG31660-RC, transcript variant C (CG31660), mRNA 
0   NM_134920.1  CG8837-RA (CG8837), mRNA 
0   NM_132525.1  CG15740-RA (CG15740), mRNA 
0   NM_132637.1  CG2453-RA (CG2453), mRNA 
0   10  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_135475.1  CG13124-RA, transcript variant A (CG13124), mRNA 
0   NM_176003.1  CG13124-RB, transcript variant B (CG13124), mRNA 
0   NM_057442.3  CG15288-RA, transcript variant A (wb), mRNA 
0   NM_165086.1  CG15288-RB, transcript variant B (wb), mRNA 
0   NM_135314.2  CG7105-RA (Proct), mRNA 
0   NM_132711.1  CG1368-RA (CG1368), mRNA 
0   NM_132455.1  CG1961-RA (CG1961), mRNA 
0   NM_169061.1  CG1961-RA (CG1961), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG1961-RA (CG1961), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_140715.2  CG7692-RA (CG7692), mRNA 
0   NM_078945.2  CG2346-RA (Fmrf), mRNA 
0   NM_141807.1  CG5214-RA (CG5214), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_079675.2  CG5452-RA (dnk), mRNA 
0   NM_137328.2  CG9010-RA (CG9010), mRNA 
0   NM_142600.2  CG4433-RA, transcript variant A (CG4433), mRNA 
0   NM_206519.1  CG4433-RB, transcript variant B (CG4433), mRNA 
0   NM_166938.1  CG2841-RC, transcript variant C (ptr), mRNA 
0   NM_080022.2  CG2841-RB, transcript variant B (ptr), mRNA 
0   NM_166937.1  CG2841-RA, transcript variant A (ptr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.