National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17061R-2 
 Symbol mthl10  Full Name methuselah-like 10 
 CG No CG17061  Old CG No CG17061 
 Synonyms mth2, anon-WO0170980.167, anon-WO0170980.166, CG17061, mthl10, methuselah-like 10, mth-like 10, Mth-like 10 
 Accession No (Link to NCBI) NM_138186.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Sung EJ, Ryuda M, Matsumoto H, Uryu O, Ochiai M, Cook ME, Yi NY, Wang H, Putney JW, Bird GS, Shears SB, Hayakawa Y.
Cytokine signaling through Drosophila Mthl10 ties lifespan to environmental stress.
Proc. Natl. Acad. Sci. U.S.A. (2017) 114(52) 13786-13791 [ PubMed ID = 29229844 ] [ RRC reference ]

Xu C, Franklin B, Tang HW, Regimbald-Dumas Y, Hu Y, Ramos J, Bosch JA, Villalta C, He X, Perrimon N.
An in vivo RNAi screen uncovers the role of AdoR signaling and adenosine deaminase in controlling intestinal stem cell activity.
Proc. Natl. Acad. Sci. U.S.A. (2019) [ PubMed ID = 31852821 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCTGGAGGATCCCTATACT 
 Primer Seq. 3'
aatctagaggtaccGCTTTGGATAGCAAACTGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCTGGAGG ATCCCCTATA CTGCGGAGTT ACATTGCTGG GCGTCCTGTG CTTGGTCGTG 
0061 TTCCGGTTGA TTCCGGGGAT TCCCTTCGNG CACTTACGTT ATGGCCGAGA GAGACCACTA 
0121 CCACACCATA GACGATCCAA ATGTGCCCTG TAATTTCTAC GATACAGTGA ATCTGACGGG 
0181 CCATAGGCTC TTTCCCAACG GAAGCTATGA TTACTACGGC ACAATAGTTC CCGCAGAATT 
0241 GGTCGGGACG TACGACTACA TACACAGCTC GCTAACGGAG CGCATAGAGG TTCGGGAACA 
0301 CGTTAGGGGA TGCGTCTGCA AGTTCAAGTC CTGCCTGAAT ATCTGNCTGC CCGTGGCGGC 
0361 AGGTCTTTAA CTCTGAAGTT GACGGATGCA TAATAGNCCA CTCGGACAAC CGAACGTGGC 
0421 CAGATNCCGC CTATGCTCAA TATAACCTTC CGCAACGAGT CTACGATATT GGTCAACATG 
0481 TTTACGCAGT TTGCTATCCA AAGC 
 in silico PCR Fragment
0001 AGCCTGGAGG AT-CCCTATA CTGCGGAGTT ACATTGCTGG GCGTCCTGTG CTTGGTCGTG 
0061 TTCCGGTTGA TTCCGGGGAT TCCCTTCG-G CACTTACGTT ATGGCCGAGA GAGACCACTA 
0121 CCACACCATA GACGATCCAA ATGTGCCCTG TAATTTCTAC GATACAGTGA ATCTGACGGG 
0181 CCATAGGCTC TTTCCCAACG GAAGCTATGA TTACTACGGC ACAATAGTTC CCGCAGAATT 
0241 GGTCGGGACG TACGACTACA TACACAGCTC GCTAACGGAG CGCATAGAGG TTCGGGAACA 
0301 CGTTAGGGGA TGCGTCTGCA AGTTCAAGTC CTGCCTGAAT ATCTG-CTGC CCGTGGCGGC 
0361 AGGTCTTTAA CTCTGAAGTT GACGGATGCA TAATAGACCA CTCGGACAAC CGAACGTGGC 
0421 CAGAT-CCGC CTATGCTCAA TATAACCTTC CGCAACGAGT CTACGATATT GGTCAACATG 
0481 TTTACGCAGT TTGCTATCCA AAGC 
 Assemble Data

17061R-2.IR_full       1   AGCCTGGAGGATCCCCTATACTGCGGAGTTACATTGCTGGGCGTCCTGTGCTTGGTCGTG 60
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
17061R-2.in silico     1   AGCCTGGAGGAT-CCCTATACTGCGGAGTTACATTGCTGGGCGTCCTGTGCTTGGTCGTG 60


17061R-2.IR_full       61  TTCCGGTTGATTCCGGGGATTCCCTTCGNGCACTTACGTTATGGCCGAGAGAGACCACTA 120
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
17061R-2.in silico     61  TTCCGGTTGATTCCGGGGATTCCCTTCG-GCACTTACGTTATGGCCGAGAGAGACCACTA 120


17061R-2.IR_full       121 CCACACCATAGACGATCCAAATGTGCCCTGTAATTTCTACGATACAGTGAATCTGACGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17061R-2.in silico     121 CCACACCATAGACGATCCAAATGTGCCCTGTAATTTCTACGATACAGTGAATCTGACGGG 180


17061R-2.IR_full       181 CCATAGGCTCTTTCCCAACGGAAGCTATGATTACTACGGCACAATAGTTCCCGCAGAATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17061R-2.in silico     181 CCATAGGCTCTTTCCCAACGGAAGCTATGATTACTACGGCACAATAGTTCCCGCAGAATT 240


17061R-2.IR_full       241 GGTCGGGACGTACGACTACATACACAGCTCGCTAACGGAGCGCATAGAGGTTCGGGAACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17061R-2.in silico     241 GGTCGGGACGTACGACTACATACACAGCTCGCTAACGGAGCGCATAGAGGTTCGGGAACA 300


17061R-2.IR_full       301 CGTTAGGGGATGCGTCTGCAAGTTCAAGTCCTGCCTGAATATCTGNCTGCCCGTGGCGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
17061R-2.in silico     301 CGTTAGGGGATGCGTCTGCAAGTTCAAGTCCTGCCTGAATATCTG-CTGCCCGTGGCGGC 360


17061R-2.IR_full       361 AGGTCTTTAACTCTGAAGTTGACGGATGCATAATAGNCCACTCGGACAACCGAACGTGGC 420
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
17061R-2.in silico     361 AGGTCTTTAACTCTGAAGTTGACGGATGCATAATAGACCACTCGGACAACCGAACGTGGC 420


17061R-2.IR_full       421 CAGATNCCGCCTATGCTCAATATAACCTTCCGCAACGAGTCTACGATATTGGTCAACATG 480
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
17061R-2.in silico     421 CAGAT-CCGCCTATGCTCAATATAACCTTCCGCAACGAGTCTACGATATTGGTCAACATG 480


17061R-2.IR_full       481 TTTACGCAGTTTGCTATCCAAAGC 504
                           ||||||||||||||||||||||||
17061R-2.in silico     481 TTTACGCAGTTTGCTATCCAAAGC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176268.1  CG17061-RB, transcript variant B (mthl10), mRNA 
100   482  NM_138186.1  CG17061-RA, transcript variant A (mthl10), mRNA 
0   NM_058098.2  CG10393-RA (amos), mRNA 
0   NM_137196.1  CG12964-RA (CG12964), mRNA 
0   NM_078530.2  CG11202-RA (org-1), mRNA 
0   NM_143329.1  CG12274-RA (CG12274), mRNA 
0   26  NM_142162.2  CG6912-RA (CG6912), mRNA 
0   14  NM_206621.1  CG33221-RA (CG33221), mRNA 
0   NM_169403.1  CG6791-RA, transcript variant A (CG6791), mRNA 
0   NM_141833.2  CG6791-RB, transcript variant B (CG6791), mRNA 
0   NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   NM_166211.2  CG30459-RA (CG30459), mRNA 
0   NM_142170.2  CG6687-RA (CG6687), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_140194.1  CG6199-RA, transcript variant A (CG6199), mRNA 
0   NM_168452.1  CG6199-RB, transcript variant B (CG6199), mRNA 
0   NM_140011.2  CG5660-RA (CG5660), mRNA 
0   NM_167242.1  CG32675-RA, transcript variant A (Tango5), mRNA 
0   NM_078650.2  CG9802-RA, transcript variant A (Cap), mRNA 
0   NM_167525.1  CG9802-RB, transcript variant B (Cap), mRNA 
0   NM_166742.1  CG31998-RA (CG31998), mRNA 
0   NM_167244.1  CG32675-RB, transcript variant B (Tango5), mRNA 
0   NM_141129.1  CG11523-RA (CG11523), mRNA 
0   NM_167243.1  CG32675-RC, transcript variant C (Tango5), mRNA 
0   NM_132885.2  CG3679-RA (CG3679), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.