National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17054R-3 
 Symbol CG34438  Full Name
 CG No CG34438  Old CG No CG17054 
 Synonyms FBgn0085467, Cap-G, BcDNA:RH49308, CG17054, CG30057, CG13327, CG13328, l(2)c00093, lethal (2) c00093, unnamed, DCAP-G, dcap-g, CapG, dCAP-G, cap-G, Cap-G:2, CG34438 
 Accession No (Link to NCBI) NM_136995.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAAAAAGCGTCTGGCGGCCACCAAAAAGACGAAAAAGGATGGTGAGAAGGAAAACGAGGA 60

                           |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCAGAGCGTGGCCACCACCTCAGACACATCCGCGGAACTCATGTACGCGATAATGCGACA 120

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCCGAGCTCAAGGAATCCCTGCACAAGCGCTACTCAAAGGAGATGCAGCAACTGTACGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAAGATGGGACACGAGTCCTTTCGCAAGGCCTTCATCAACGTGTTGAAAGCCGTCCTAGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCTGAGGAGGGCAATGAGAACGCAAACATGGCCCTCAACTTCTGCGCCACTTTCGTCAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGCTCAGATTCGGATGGTACTGAGCCCATGCTGGCCGAAACCTTTCATTGGCTGCTTAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACCTATTCGAGCAACCCGCACATACGTTATCGCATCTGTTACTTTGTGAATCTTATACT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TAAGGAGCTCGGACCCAATGCCGCCTTGGATGACCACCAGTGCGATGATATACTGGAAGC 480

17054R-3.IR_full       481 AATGCTGGACCGGGTGAAGG 500
                           |||||||||||||||||||| silico     481 AATGCTGGACCGGGTGAAGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206103.1  CG17054-RD, transcript variant D (Cap-G), mRNA 
100   482  NM_206104.1  CG17054-RC, transcript variant C (Cap-G), mRNA 
100   482  NM_136995.2  CG17054-RA, transcript variant A (Cap-G), mRNA 
100   482  NM_206105.1  CG17054-RB, transcript variant B (Cap-G), mRNA 
0   NM_169479.1  CG10120-RA, transcript variant A (Men), mRNA 
0   NM_080141.2  CG10120-RB, transcript variant B (Men), mRNA 
0   NM_168667.1  CG32159-RB (CG32159), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_132851.2  CG8509-RA (CG8509), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_142826.2  CG4910-RA (Ccap), mRNA 
0   NM_141984.1  CG14384-RA (CG14384), mRNA 
0   NM_167275.1  CG32668-RA (CG32668), mRNA 
0   NM_058007.3  CG1071-RA (E2f2), mRNA 
0   NM_133131.1  CG7914-RA (CG7914), mRNA 
0   NM_142755.1  CG5732-RA (CG5732), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_133070.1  CG15046-RA (CG15046), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   NM_206573.1  CG31094-RB, transcript variant B (LpR1), mRNA 
0   NM_165178.1  CG17332-RD, transcript variant D (VhaSFD), mRNA 
0   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   NM_078861.2  CG17332-RA, transcript variant A (VhaSFD), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_079320.2  CG10620-RA (Tsf2), mRNA 
0   NM_142779.1  CG13856-RA (CG13856), mRNA 
0   NM_001014759.1  CG33517-RB, transcript variant B (D2R), mRNA 
0   NM_137340.2  CG8950-RA (CG8950), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.