National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17054R-2 
 Symbol CG34438  Full Name
 CG No CG34438  Old CG No CG17054 
 Synonyms FBgn0085467, Cap-G, BcDNA:RH49308, CG17054, CG30057, CG13327, CG13328, l(2)c00093, lethal (2) c00093, unnamed, DCAP-G, dcap-g, CapG, dCAP-G, cap-G, Cap-G:2, CG34438 
 Accession No (Link to NCBI) NM_136995.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAAAAAGCGTCTGGCGGCCAC 
 Primer Seq. 3'
aatctagaggtaccCCTTCACCCGGTCCAGCATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAAAAAGCGT CTGGCGGCCA CCAAAAAGAC GAAAAAGGAT GGTGAGAAGG AAAACGAGGA 
0061 TCAGAGCGTG NCCACCACCT CAGACACATC CGCGGAACTC ATGTACGCGA TAATGCGACA 
0121 AGNCGAGCTC AAGGAATCCC TGCACAAGCG CTACTCAAAG GAGATGCAGC AACTGTACGC 
0181 AAAGATGGGA CACGAGTCCT TTCGCAAGGC CTTCATCAAC GTGTTGAAAG CCGTCCTAGG 
0241 GGCTGAGGAG GGCAATGAGA ACGCAAACAT GGCCCTCAAC TTCTGCGCCA CTTTCGTCAC 
0301 CAGCTCAGAT TCGGATGGTA CTGAGCCCAT GCTGGCCGAA ACCTTTCATT GGCTGCTTAC 
0361 GACCTATTCG AGCAACCCGC ACATACGTTA TCGCATCTGT TACTTTGTGA ATCTTATACT 
0421 TAAGGAGCTC GGACCCAATG CCGCCTTGGA TGACCACCAG TGCGATGATA TACTGGAAGC 
0481 AATGCTGGAC CGGGTGAAGG  
 in silico PCR Fragment
0001 AAAAAAGCGT CTGGCGGCCA CCAAAAAGAC GAAAAAGGAT GGTGAGAAGG AAAACGAGGA 
0061 TCAGAGCGTG GCCACCACCT CAGACACATC CGCGGAACTC ATGTACGCGA TAATGCGACA 
0121 AGCCGAGCTC AAGGAATCCC TGCACAAGCG CTACTCAAAG GAGATGCAGC AACTGTACGC 
0181 AAAGATGGGA CACGAGTCCT TTCGCAAGGC CTTCATCAAC GTGTTGAAAG CCGTCCTAGG 
0241 GGCTGAGGAG GGCAATGAGA ACGCAAACAT GGCCCTCAAC TTCTGCGCCA CTTTCGTCAC 
0301 CAGCTCAGAT TCGGATGGTA CTGAGCCCAT GCTGGCCGAA ACCTTTCATT GGCTGCTTAC 
0361 GACCTATTCG AGCAACCCGC ACATACGTTA TCGCATCTGT TACTTTGTGA ATCTTATACT 
0421 TAAGGAGCTC GGACCCAATG CCGCCTTGGA TGACCACCAG TGCGATGATA TACTGGAAGC 
0481 AATGCTGGAC CGGGTGAAGG  
 Assemble Data

17054R-2.IR_full       1   AAAAAAGCGTCTGGCGGCCACCAAAAAGACGAAAAAGGATGGTGAGAAGGAAAACGAGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     1   AAAAAAGCGTCTGGCGGCCACCAAAAAGACGAAAAAGGATGGTGAGAAGGAAAACGAGGA 60


17054R-2.IR_full       61  TCAGAGCGTGNCCACCACCTCAGACACATCCGCGGAACTCATGTACGCGATAATGCGACA 120
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     61  TCAGAGCGTGGCCACCACCTCAGACACATCCGCGGAACTCATGTACGCGATAATGCGACA 120


17054R-2.IR_full       121 AGNCGAGCTCAAGGAATCCCTGCACAAGCGCTACTCAAAGGAGATGCAGCAACTGTACGC 180
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     121 AGCCGAGCTCAAGGAATCCCTGCACAAGCGCTACTCAAAGGAGATGCAGCAACTGTACGC 180


17054R-2.IR_full       181 AAAGATGGGACACGAGTCCTTTCGCAAGGCCTTCATCAACGTGTTGAAAGCCGTCCTAGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     181 AAAGATGGGACACGAGTCCTTTCGCAAGGCCTTCATCAACGTGTTGAAAGCCGTCCTAGG 240


17054R-2.IR_full       241 GGCTGAGGAGGGCAATGAGAACGCAAACATGGCCCTCAACTTCTGCGCCACTTTCGTCAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     241 GGCTGAGGAGGGCAATGAGAACGCAAACATGGCCCTCAACTTCTGCGCCACTTTCGTCAC 300


17054R-2.IR_full       301 CAGCTCAGATTCGGATGGTACTGAGCCCATGCTGGCCGAAACCTTTCATTGGCTGCTTAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     301 CAGCTCAGATTCGGATGGTACTGAGCCCATGCTGGCCGAAACCTTTCATTGGCTGCTTAC 360


17054R-2.IR_full       361 GACCTATTCGAGCAACCCGCACATACGTTATCGCATCTGTTACTTTGTGAATCTTATACT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     361 GACCTATTCGAGCAACCCGCACATACGTTATCGCATCTGTTACTTTGTGAATCTTATACT 420


17054R-2.IR_full       421 TAAGGAGCTCGGACCCAATGCCGCCTTGGATGACCACCAGTGCGATGATATACTGGAAGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17054R-2.in silico     421 TAAGGAGCTCGGACCCAATGCCGCCTTGGATGACCACCAGTGCGATGATATACTGGAAGC 480


17054R-2.IR_full       481 AATGCTGGACCGGGTGAAGG 500
                           ||||||||||||||||||||
17054R-2.in silico     481 AATGCTGGACCGGGTGAAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206103.1  CG17054-RD, transcript variant D (Cap-G), mRNA 
100   482  NM_206104.1  CG17054-RC, transcript variant C (Cap-G), mRNA 
100   482  NM_136995.2  CG17054-RA, transcript variant A (Cap-G), mRNA 
100   482  NM_206105.1  CG17054-RB, transcript variant B (Cap-G), mRNA 
0   NM_169479.1  CG10120-RA, transcript variant A (Men), mRNA 
0   NM_080141.2  CG10120-RB, transcript variant B (Men), mRNA 
0   NM_168667.1  CG32159-RB (CG32159), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_132851.2  CG8509-RA (CG8509), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_142826.2  CG4910-RA (Ccap), mRNA 
0   NM_141984.1  CG14384-RA (CG14384), mRNA 
0   NM_167275.1  CG32668-RA (CG32668), mRNA 
0   NM_058007.3  CG1071-RA (E2f2), mRNA 
0   NM_133131.1  CG7914-RA (CG7914), mRNA 
0   NM_142755.1  CG5732-RA (CG5732), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_133070.1  CG15046-RA (CG15046), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   NM_206573.1  CG31094-RB, transcript variant B (LpR1), mRNA 
0   NM_165178.1  CG17332-RD, transcript variant D (VhaSFD), mRNA 
0   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   NM_078861.2  CG17332-RA, transcript variant A (VhaSFD), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_079320.2  CG10620-RA (Tsf2), mRNA 
0   NM_142779.1  CG13856-RA (CG13856), mRNA 
0   NM_001014759.1  CG33517-RB, transcript variant B (D2R), mRNA 
0   NM_137340.2  CG8950-RA (CG8950), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.