National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1704R-1 
 Symbol CG33713  Full Name CG33713 
 CG No CG33713  Old CG No CG1704 
 Synonyms cg1704, CG33071, CG1704, CG33071-ORFB, CG33713 
 Accession No (Link to NCBI) NM_001031915.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ryuda M, Tsuzuki S, Matsumoto H, Oda Y, Tanimura T, Hayakawa Y.
Identification of a novel gene, anorexia, regulating feeding activity via insulin signaling in Drosophila melanogaster.
J Biol Chem (2011) 286(44) 38417-26 [ PubMed ID = 21917925 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGTGCACCGCATTTTCGTGG 
 Primer Seq. 3'
aatctagaggtaccCTCCTTCACGTGGTCAAACAG 
 Predicted Fragment Size
676 
 IR fragment full Seq
0001 CAGTGCACCG CATTTTCGTG GGCAATCTAC CGTGGACAGT GGGCCACCAG GAGTTGCGTG 
0061 GCTACTTCCG CGAGTTCGGA CGCGTGGTGT CCGCCCAACG TGATCTTCGA CAAGCGAACG 
0121 GGGTGCTCGA AGGGCTACGG TTTCGTTAGC TTCAACAGTT TGACCGCGCT GGAGAAGATC 
0181 GAGAACGAGC AGAAGCACAT ACTGGAGGGC AACTACCTAA ACATACAGAA ATCTTAGATT 
0241 CCCCACTTTA ATTGTCATTT AGTTTATAAG CTCAGCAGAT TTTTTTTTTT TTTGACATGT 
0301 CGGACAGCGA TACGGACACC GTGGACGAGC TTTTCCACCT TGCCACCGAG CATGTGGCCA 
0361 AGCAGTCAAA CAGCATTGGT TCCGCGGACC TTTTAATATT TTACGGATAC TACAAGCAGG 
0421 CCACGAATGG CCCCTGCAAG GAGCAAAGTC CGGGTCTGCT TCAACTGCAG GCCAAGAGCA 
0481 AGTGGCAGGC TTGGCGGAAT CTGGGAACAA TGTCCCAGTC CGCTGCCCGG CAGGCCTACG 
0541 TCCAGAAGCT GCAGGAGCTT CAACCCAACT GGCGGTCCCG GCGCAACCCA GGCTGGGTCG 
0601 TTCATTCCAT TGAGTCGGTC CCACTGGAGG ACCAACGTTT GGACAGTGAA AAGACCCTGT 
0661 TTGACCACGT GAAGGAG 
 in silico PCR Fragment
0001 CAGTGCACCG CATTTTCGTG GGCAATCTAC CGTGGACAGT GGGCCACCAG GAGTTGCGTG 
0061 GCTACTTCCG CGAGTTCGGA CGCGTGGTGT CCG-CCAACG TGATCTTCGA CAAGCGAACG 
0121 GGGTGCTCGA AGGGCTACGG TTTCGTTAGC TTCAACAGTT TGACCGCGCT GGAGAAGATC 
0181 GAGAACGAGC AGAAGCACAT ACTGGAGGGC AACTACCTAA ACATACAGAA ATCTTAGATT 
0241 CCCCACTTTA ATTGTCATTT AGTTTATAAG CTCAGCAGAT TTTTTTTTTT TTTGACATGT 
0301 CGGACAGCGA TACGGACACC GTGGACGAGC TTTTCCACCT TGCCACCGAG CATGTGGCCA 
0361 AGCAGTCAAA CAGCATTGGT TCCGCGGACC TTTTAATATT TTACGGATAC TACAAGCAGG 
0421 CCACGAATGG CCCCTGCAAG GAGCAAAGTC CGGGTCTGCT TCAACTGCAG GCCAAGAGCA 
0481 AGTGGCAGGC TTGGCGCAAT CTGGGAACAA TGTCCCAGTC CGCTGCCCGG CAGGCCTACG 
0541 TCCAGAAGCT GCAGGAGCTT CAACCCAACT GGCGGTCCCG GCGCAACCCA GGCTGGGTCG 
0601 TTCATTCCAT TGAGTCGGTC CCACTGGAGG ACCAACGTTT GGACAGTGAA AAGACCCTGT 
0661 TTGACCACGT GAAGGAG 
 Assemble Data

1704R-1.IR_full       1   CAGTGCACCGCATTTTCGTGGGCAATCTACCGTGGACAGTGGGCCACCAGGAGTTGCGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     1   CAGTGCACCGCATTTTCGTGGGCAATCTACCGTGGACAGTGGGCCACCAGGAGTTGCGTG 60


1704R-1.IR_full       61  GCTACTTCCGCGAGTTCGGACGCGTGGTGTCCGCCCAACGTGATCTTCGACAAGCGAACG 120
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
1704R-1.in silico     61  GCTACTTCCGCGAGTTCGGACGCGTGGTGTCCG-CCAACGTGATCTTCGACAAGCGAACG 120


1704R-1.IR_full       121 GGGTGCTCGAAGGGCTACGGTTTCGTTAGCTTCAACAGTTTGACCGCGCTGGAGAAGATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     121 GGGTGCTCGAAGGGCTACGGTTTCGTTAGCTTCAACAGTTTGACCGCGCTGGAGAAGATC 180


1704R-1.IR_full       181 GAGAACGAGCAGAAGCACATACTGGAGGGCAACTACCTAAACATACAGAAATCTTAGATT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     181 GAGAACGAGCAGAAGCACATACTGGAGGGCAACTACCTAAACATACAGAAATCTTAGATT 240


1704R-1.IR_full       241 CCCCACTTTAATTGTCATTTAGTTTATAAGCTCAGCAGATTTTTTTTTTTTTTGACATGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     241 CCCCACTTTAATTGTCATTTAGTTTATAAGCTCAGCAGATTTTTTTTTTTTTTGACATGT 300


1704R-1.IR_full       301 CGGACAGCGATACGGACACCGTGGACGAGCTTTTCCACCTTGCCACCGAGCATGTGGCCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     301 CGGACAGCGATACGGACACCGTGGACGAGCTTTTCCACCTTGCCACCGAGCATGTGGCCA 360


1704R-1.IR_full       361 AGCAGTCAAACAGCATTGGTTCCGCGGACCTTTTAATATTTTACGGATACTACAAGCAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     361 AGCAGTCAAACAGCATTGGTTCCGCGGACCTTTTAATATTTTACGGATACTACAAGCAGG 420


1704R-1.IR_full       421 CCACGAATGGCCCCTGCAAGGAGCAAAGTCCGGGTCTGCTTCAACTGCAGGCCAAGAGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     421 CCACGAATGGCCCCTGCAAGGAGCAAAGTCCGGGTCTGCTTCAACTGCAGGCCAAGAGCA 480


1704R-1.IR_full       481 AGTGGCAGGCTTGGCGGAATCTGGGAACAATGTCCCAGTCCGCTGCCCGGCAGGCCTACG 540
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     481 AGTGGCAGGCTTGGCGCAATCTGGGAACAATGTCCCAGTCCGCTGCCCGGCAGGCCTACG 540


1704R-1.IR_full       541 TCCAGAAGCTGCAGGAGCTTCAACCCAACTGGCGGTCCCGGCGCAACCCAGGCTGGGTCG 600
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     541 TCCAGAAGCTGCAGGAGCTTCAACCCAACTGGCGGTCCCGGCGCAACCCAGGCTGGGTCG 600


1704R-1.IR_full       601 TTCATTCCATTGAGTCGGTCCCACTGGAGGACCAACGTTTGGACAGTGAAAAGACCCTGT 660
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1704R-1.in silico     601 TTCATTCCATTGAGTCGGTCCCACTGGAGGACCAACGTTTGGACAGTGAAAAGACCCTGT 660


1704R-1.IR_full       661 TTGACCACGTGAAGGAG 677
                          |||||||||||||||||
1704R-1.in silico     661 TTGACCACGTGAAGGAG 677

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   658  NM_001031915.1  CG33713-RA, transcript variant A (CG33713), mRNA 
100   658  NM_001031914.1  CG33713-RB, transcript variant B (CG33713), mRNA 
100   658  NM_001031912.1  CG33714-RB, transcript variant B (CG33714), mRNA 
100   658  NM_001031913.1  CG33714-RA, transcript variant A (CG33714), mRNA 
0.15   NM_001014692.1  CG31992-RG, transcript variant G (gw), mRNA 
0.15   NM_166781.1  CG31992-RB, transcript variant B (gw), mRNA 
0.15   NM_001014691.1  CG31992-RH, transcript variant H (gw), mRNA 
0.15   NM_166784.1  CG31992-RE, transcript variant E (gw), mRNA 
0.15   NM_166782.1  CG31992-RC, transcript variant C (gw), mRNA 
0.15   NM_166783.1  CG31992-RD, transcript variant D (gw), mRNA 
0.15   NM_166780.1  CG31992-RA, transcript variant A (gw), mRNA 
0.15   NM_166785.1  CG31992-RF, transcript variant F (gw), mRNA 
0   NM_139825.1  CG15829-RA (CG15829), mRNA 
0   NM_167187.1  CG17754-RC, transcript variant C (CG17754), mRNA 
0   NM_132321.3  CG17754-RA, transcript variant A (CG17754), mRNA 
0   NM_134500.2  CG14224-RA (CG14224), mRNA 
0   NM_135953.2  CG5968-RA (CG5968), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_166501.1  CG6393-RB, transcript variant B (CG6393), mRNA 
0   NM_139778.2  CG10274-RA (CG10274), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_169903.1  CG5191-RE, transcript variant E (CG5191), mRNA 
0   NM_169905.1  CG5191-RD, transcript variant D (CG5191), mRNA 
0   NM_142636.1  CG5191-RB, transcript variant B (CG5191), mRNA 
0   NM_169904.1  CG5191-RA, transcript variant A (CG5191), mRNA 
0   NM_135320.2  CG7093-RA (CG7093), mRNA 
0   NM_170042.1  CG31281-RA (CG31281), mRNA 
0   NM_079625.2  CG8573-RA, transcript variant A (su(Hw)), mRNA 
0   NM_169574.1  CG8573-RB, transcript variant B (su(Hw)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.