National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17043R-4 
 Symbol CG32843  Full Name CG32843 
 CG No CG32843  Old CG No CG17043 
 Synonyms CG17415, CG17043, anon-WO0170980.137, anon-WO0170980.136, CG32843 
 Accession No (Link to NCBI) NM_165979.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CATGCCGAATTCGGAGCTACTGCATCAGAGTCCGATGCGCTGCGTTGCCCTGCACATAAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCTACACTACTTCCTCCTGTCCAATTACTCCTGGATGCTCTGCGAGGGATTCTATCTGCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CACCGTCCTCGTCGCCGCATTCATTTCCGAGAAGAGGCTGGTCAAATGGCTCATCGCATT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     181 CGGCTGGGGCTCCCCGGCCATCGTCATATTCGTCTATAGCATGGCTCGCGGT-CTGGGCG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCACGCCCGAGGACAATCGTCACTGCTGGATGAACCAAACCAACTACCAAAACATTCTTA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGTGCCTGTGTGTATCTCCATGTTCCTGAACCTCCTGTTCCTGTGCAACATTGTGCGAG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGTCCTTTTGAAACTGAATGCCCCGGCCAGTATTCAGGGCAGCTGCGGTCCATCGCGAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGGTTTTGCAAGCATTTCGGGCAACGCTGCTTTTGGTTCCTCTGCTCGGCCTCCAGTACA 480

17043R-4.IR_full       481 TCCTTACGCCCTTTCGTCCTG 501
                           ||||||||||||||||||||| silico     481 TCCTTACGCCCTTTCGTCCTG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165979.1  CG32843-RA (CG32843), mRNA 
0   NM_135724.2  CG5427-RA (Oatp33Ea), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_168718.2  CG32169-RA (CG32169), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_175961.1  CG15630-RA (CG15630), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_170082.1  CG10251-RA (CG10251), mRNA 
0   NM_206632.1  CG3566-RC, transcript variant C (CG3566), mRNA 
0   NM_139574.2  CG32262-RA (CG32262), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   36  59  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_001015215.1  CG40158-PA.3 (CG40158), mRNA 
0   NM_138223.1  CG12502-RA (CG12502), mRNA 
0   NM_166554.1  CG3612-RA (blw), mRNA 
0   NM_140408.2  CG8745-RA (CG8745), mRNA 
0   NM_143499.2  CG15524-RA (CG15524), mRNA 
0   NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_137247.1  CG8434-RA (lbk), mRNA 
0   NM_206412.1  CG10508-RF, transcript variant F (CG10508), mRNA 
0   NM_176383.2  CG10508-RE, transcript variant E (CG10508), mRNA 
0   NM_176384.2  CG10508-RC, transcript variant C (CG10508), mRNA 
0   NM_176382.2  CG10508-RD, transcript variant D (CG10508), mRNA 
0   NM_141436.2  CG1091-RB, transcript variant B (CG1091), mRNA 
0   NM_169169.2  CG1091-RA, transcript variant A (CG1091), mRNA 
0   NM_170032.2  CG5248-RB, transcript variant B (loco), mRNA 
0   NM_170031.1  CG5248-RA, transcript variant A (loco), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.