National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17043R-1 
 Symbol CG32843  Full Name CG32843 
 CG No CG32843  Old CG No CG17043 
 Synonyms CG17415, CG17043, anon-WO0170980.137, anon-WO0170980.136, CG32843 
 Accession No (Link to NCBI) NM_165979.1 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATGCCGAATTCGGAGCTACT 
 Primer Seq. 3'
aatctagaggtaccCAGGACGAAAGGGCGTAAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATGCCGAAT TCGGAGCTAC TGCATCAGAG TCCGATGCGC TGCGTTGCCC TGCACATAAC 
0061 GCTACACTAC TTCCTCCTGT CCAATTACTC CTGGATGCTC TGCGAGGGAT TCTATCTGCA 
0121 CACCGTCCTC GTCGCCGCAT TCATTTCCGA GAAGAGGCTG GTCAAATGGC TCATCGCATT 
0181 CGGCTGGGGC TCCCCGGCCA TCGTCATATT CGTCTATAGC ATGGCTCGCG GTNCTGGGCG 
0241 GCACGCCCGA GGACAATCGT CACTGCTGGA TGAACCAAAC CAACTACCAA AACATTCTTA 
0301 TGGTGCCTGT GTGTATCTCC ATGTTCCTGA ACCTCCTGTT CCTGTGCAAC ATTGTGCGAG 
0361 TGGTCCTTTT GAAACTGAAT GCCCCGGCCA GTATTCAGGG CAGCTGCGGT CCATCGCGAA 
0421 CGGTTTTGCA AGCATTTCGG GCAACGCTGC TTTTGGTTCC TCTGCTCGGC CTCCAGTACA 
0481 TCCTTACGCC CTTTCGTCCT G 
 in silico PCR Fragment
0001 CATGCCGAAT TCGGAGCTAC TGCATCAGAG TCCGATGCGC TGCGTTGCCC TGCACATAAC 
0061 GCTACACTAC TTCCTCCTGT CCAATTACTC CTGGATGCTC TGCGAGGGAT TCTATCTGCA 
0121 CACCGTCCTC GTCGCCGCAT TCATTTCCGA GAAGAGGCTG GTCAAATGGC TCATCGCATT 
0181 CGGCTGGGGC TCCCCGGCCA TCGTCATATT CGTCTATAGC ATGGCTCGCG GT-CTGGGCG 
0241 GCACGCCCGA GGACAATCGT CACTGCTGGA TGAACCAAAC CAACTACCAA AACATTCTTA 
0301 TGGTGCCTGT GTGTATCTCC ATGTTCCTGA ACCTCCTGTT CCTGTGCAAC ATTGTGCGAG 
0361 TGGTCCTTTT GAAACTGAAT GCCCCGGCCA GTATTCAGGG CAGCTGCGGT CCATCGCGAA 
0421 CGGTTTTGCA AGCATTTCGG GCAACGCTGC TTTTGGTTCC TCTGCTCGGC CTCCAGTACA 
0481 TCCTTACGCC CTTTCGTCCT G 
 Assemble Data

17043R-1.IR_full       1   CATGCCGAATTCGGAGCTACTGCATCAGAGTCCGATGCGCTGCGTTGCCCTGCACATAAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     1   CATGCCGAATTCGGAGCTACTGCATCAGAGTCCGATGCGCTGCGTTGCCCTGCACATAAC 60


17043R-1.IR_full       61  GCTACACTACTTCCTCCTGTCCAATTACTCCTGGATGCTCTGCGAGGGATTCTATCTGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     61  GCTACACTACTTCCTCCTGTCCAATTACTCCTGGATGCTCTGCGAGGGATTCTATCTGCA 120


17043R-1.IR_full       121 CACCGTCCTCGTCGCCGCATTCATTTCCGAGAAGAGGCTGGTCAAATGGCTCATCGCATT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     121 CACCGTCCTCGTCGCCGCATTCATTTCCGAGAAGAGGCTGGTCAAATGGCTCATCGCATT 180


17043R-1.IR_full       181 CGGCTGGGGCTCCCCGGCCATCGTCATATTCGTCTATAGCATGGCTCGCGGTNCTGGGCG 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
17043R-1.in silico     181 CGGCTGGGGCTCCCCGGCCATCGTCATATTCGTCTATAGCATGGCTCGCGGT-CTGGGCG 240


17043R-1.IR_full       241 GCACGCCCGAGGACAATCGTCACTGCTGGATGAACCAAACCAACTACCAAAACATTCTTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     241 GCACGCCCGAGGACAATCGTCACTGCTGGATGAACCAAACCAACTACCAAAACATTCTTA 300


17043R-1.IR_full       301 TGGTGCCTGTGTGTATCTCCATGTTCCTGAACCTCCTGTTCCTGTGCAACATTGTGCGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     301 TGGTGCCTGTGTGTATCTCCATGTTCCTGAACCTCCTGTTCCTGTGCAACATTGTGCGAG 360


17043R-1.IR_full       361 TGGTCCTTTTGAAACTGAATGCCCCGGCCAGTATTCAGGGCAGCTGCGGTCCATCGCGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     361 TGGTCCTTTTGAAACTGAATGCCCCGGCCAGTATTCAGGGCAGCTGCGGTCCATCGCGAA 420


17043R-1.IR_full       421 CGGTTTTGCAAGCATTTCGGGCAACGCTGCTTTTGGTTCCTCTGCTCGGCCTCCAGTACA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17043R-1.in silico     421 CGGTTTTGCAAGCATTTCGGGCAACGCTGCTTTTGGTTCCTCTGCTCGGCCTCCAGTACA 480


17043R-1.IR_full       481 TCCTTACGCCCTTTCGTCCTG 501
                           |||||||||||||||||||||
17043R-1.in silico     481 TCCTTACGCCCTTTCGTCCTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165979.1  CG32843-RA (CG32843), mRNA 
0   NM_135724.2  CG5427-RA (Oatp33Ea), mRNA 
0   NM_136041.1  CG10231-RA (Pde11), mRNA 
0   NM_168718.2  CG32169-RA (CG32169), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_175961.1  CG15630-RA (CG15630), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_170082.1  CG10251-RA (CG10251), mRNA 
0   NM_206632.1  CG3566-RC, transcript variant C (CG3566), mRNA 
0   NM_139574.2  CG32262-RA (CG32262), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   36  59  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_001015215.1  CG40158-PA.3 (CG40158), mRNA 
0   NM_138223.1  CG12502-RA (CG12502), mRNA 
0   NM_166554.1  CG3612-RA (blw), mRNA 
0   NM_140408.2  CG8745-RA (CG8745), mRNA 
0   NM_143499.2  CG15524-RA (CG15524), mRNA 
0   NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_137247.1  CG8434-RA (lbk), mRNA 
0   NM_206412.1  CG10508-RF, transcript variant F (CG10508), mRNA 
0   NM_176383.2  CG10508-RE, transcript variant E (CG10508), mRNA 
0   NM_176384.2  CG10508-RC, transcript variant C (CG10508), mRNA 
0   NM_176382.2  CG10508-RD, transcript variant D (CG10508), mRNA 
0   NM_141436.2  CG1091-RB, transcript variant B (CG1091), mRNA 
0   NM_169169.2  CG1091-RA, transcript variant A (CG1091), mRNA 
0   NM_170032.2  CG5248-RB, transcript variant B (loco), mRNA 
0   NM_170031.1  CG5248-RA, transcript variant A (loco), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.